Skip to comments.
Merkel moves to open up Germany to US gas imports after Trump's push: report
The Hill ^
| 10/22/2018
| Megan Keller
Posted on 10/22/2018 7:07:28 PM PDT by ding_dong_daddy_from_dumas
German Chancellor Angela Merkel is making a move to open up Germany's market to U.S. gas companies, following a lobbying push from President Trump, The Wall Street Journal reported.
Merkel told a group of lawmakers over breakfast in October that her government will co-finance a $576 million liquified natural gas (LNG) shipping terminal in northern Germany, the Journal reported, citing people familiar with the meeting.
The project had been stalled for years, but Trump has lobbied hard for Europe to increase LNG purchases from the U.S. while reducing their reliance on Russia.
Germany gets most of its gas from Russia, and American efforts to open its market to U.S. companies has stalled due to lack of government support.
(Excerpt) Read more at thehill.com ...
TOPICS: Business/Economy; Egypt; Front Page News; Germany; Israel; News/Current Events; Russia; United Kingdom
KEYWORDS: angelamerkel; anwr; bidenflation; brexit; cyprus; eastmed; eastmedpipeline; egypt; energy; europe; europeanunion; germany; greece; hydrocarbons; israel; keystonexl; lng; maga; megankeller; methane; nato; nordstream; nordstream2; opec; pipeline; putin; putinsbuttboys; russia; thehill; theresamay; theshill; ukraine; unitedkingdom
win/win, apparently
To: ding_dong_daddy_from_dumas
total win/win
reduces the U.S. deficit to Germany/EU
reduces Germany/EU energy dependence on Russia
2
posted on
10/22/2018 7:21:19 PM PDT
by
catnipman
((Cat Nipman: Vote Republican in 2012 and only be called racist one more time!))
To: ding_dong_daddy_from_dumas
Definitely a win/win for the US and Germany. Germany will now have another source for natural glass and therefore less likely to be subjected to supplier blackmail.
3
posted on
10/22/2018 7:21:41 PM PDT
by
House Atreides
(BOYCOTT the NFL, its products and players 100% - PERMANENTL)
To: ding_dong_daddy_from_dumas
WINNING!!!
4
posted on
10/22/2018 7:27:08 PM PDT
by
Chode
( WeÂ’re America, Bitch!)
To: ding_dong_daddy_from_dumas
we have an amazing President.
5
posted on
10/22/2018 7:39:16 PM PDT
by
elpadre
(AfganistaMr Obama said theoal was to "disrupt, dismantle and defeat al-hereQaeda" and its allies.)
To: elpadre
President Trump, you magnificent bastard.
To: ding_dong_daddy_from_dumas
How much LNG can a $576 million terminal handle? Any guesses?
7
posted on
10/22/2018 7:46:19 PM PDT
by
Paul R.
To: ding_dong_daddy_from_dumas
An LNG terminal allows Germany to buy from any supplier, a pipeline locks them into a single supplier - who has repeatedly shown they will use such dependence as a weapon.
Also, most of jobs and construction contracts for a pipeline would go to the Russians, while an LNG terminal would be a huge load of jobs and contracts that German politicians could dole out domestically.
If Russians give the best price, they can still supply their tanker loads.
8
posted on
10/22/2018 7:54:22 PM PDT
by
BeauBo
To: ding_dong_daddy_from_dumas
I saw Secretary of the Interior Zinke in an interview recently.
He was confidently predicting big increases in US production over the next two years.
We will need places for that product to go.
9
posted on
10/22/2018 7:57:04 PM PDT
by
BeauBo
To: AdmSmith; AnonymousConservative; Arthur Wildfire! March; Berosus; Bockscar; cardinal4; ColdOne; ...
Over ten years ago, the German Green Party got pebble bed architecture for nuclear power killed in Germany (which is where most of the development work was done, along with I think South Africa), so watch for LNG use to rise precipitously as more of Germany's (and Europe in general) electrical power comes from fuel cells with reformers running methane. Geographically (and from a scenic tourism standpoint), photovoltaics would be a difficult fit for much of Europe.
10
posted on
10/22/2018 10:18:20 PM PDT
by
SunkenCiv
(and btw -- https://www.gofundme.com/for-rotator-cuff-repair-surgery)
To: ding_dong_daddy_from_dumas
American efforts to open its market to U.S. companies has stalled due to lack of government support(from the U.S. government.)
11
posted on
10/22/2018 10:40:52 PM PDT
by
Jeff Chandler
(Every time a lefty cries "racism", a Trump voter gets his wings.)
To: ding_dong_daddy_from_dumas; SunkenCiv
There are several proposed terminals:
Co-financed by Macquarie Group Ltd. and China Harbour Engineering Co. and costing as much as 500 million euros ($575 million), closely held consortium LNG Stade GmbH plans a terminal that will eventually be able to handle as much as 15 percent of Germanys gas imports.
Brunsbuettel + a joint venture of gas infrastructure company NV Nederlandse Gasunie, Vopak LNG Holding BV and Oiltanking GmbH, bundled together as German LNG Terminal.
Qatar, and Uniper SE a terminal at Wilhelmshaven, about 55 miles west of Stade
https://www.bloomberg.com/news/articles/2018-10-22/two-small-towns-in-germany-vie-to-make-trump-s-lng-dream-reality
12
posted on
10/23/2018 12:39:44 AM PDT
by
AdmSmith
(GCTGATATGTCTATGATTACTCAT)
This topic was posted , thanks ding_dong_daddy_from_dumas.
The rest of the LNG keyword, sorted:
- Poland and Norway open 'milestone' trans-Baltic gas pipeline [09/27/2022]
- Blinken: US will not be able to stop Israel if Hezbollah attacks over gas [09/25/2022]
- Russia's Gas Exports To Europe Drop By 82% In A Year [09/24/2022]
- The EUthanized EUropean nat-gas "reserves" [09/21/2022]
- Germany fears inevitable bankruptcy amid energy crisis [09/16/2022]
- Germany charters fifth floating LNG terminal [09/07/2022]
- Europe plan for floating gas terminals raises climate fears [08/31/2022]
- Natural Gas Demand Outpaces Production (Russia's gas output in June was at 70 percent of March levels) [08/22/2022]
- Europe's Latest Natural Gas Pipeline Plan Won't Solve Its Current Crisis [08/21/2022]
- Erdogan Blasts Israel For Defending Itself-The Turkish tyrant draws a dangerous red line. [08/16/2022]
- World's Largest Chemical Company to Cut Down on Ammonia Production, a Key Ingredient in Fertilizers...The price of ammonia is closely linked with that of natural gas [08/03/2022]
- Will Russia Cut Natural Gas Flows To Europe? [07/30/2022]
- The U.S. Becomes World's Top LNG Exporter [07/26/2022]
- China locks in record long-term LNG deals to bolster energy security [07/10/2022]
- Can gas exports to EUROPE end the Russian war? Dr. Daniel Fine on the geopolitics of the Russian/Ukraine war and how it will end... [07/06/2022]
- Biden admin preventing America's second-largest LNG plant from restarting operations [07/05/2022]
- Germany's union head warns cutting off Russian gas could topple major industries [07/04/2022]
- EU imports more US LNG than Russia's gas, first time in history -- IEA [07/01/2022]
- Germany triggers gas alarm stage, accuses Russia of 'economic attack' [06/23/2022]
- Did Russian hackers blow up a Texas LNG pipeline on June 8? [06/22/2022]
- EU, Israel and Egypt sign deal to boost East Med gas exports to Europe [06/15/2022]
- European Commission president heads to Israel with gas deal in the works [06/12/2022]
- Freeport (Quintana, Texas) LNG (Liquid Natural Gas) to shut down for three weeks minimum following explosion [06/09/2022]
- European Gas Soars After US LNG Terminal Explosion Halts Exports For Weeks [06/09/2022]
- "The Market Has Exploded": LNG Charter Rates Soar As Traders Rush To Secure Tankers [06/06/2022]
- European Natural Gas Prices To Triple In "Perfect Storm" [05/16/2022]
- Lithuania ceasing all Russian gas imports for domestic needs (first European country) [04/02/2022]
- Japan: No intention to withdraw from oil, LNG projects in Russia [04/02/2022]
- Europe Woos Qatar for an Alternative to Russian Gas [03/30/2022]
- U.S., EU strike LNG deal as Europe seeks to cut Russian gas [03/25/2022]
- Germany to 'fast-track' gas terminals as part of Qatar deal [03/20/2022]
- Soaring LNG Demand Creates Traffic Jam At Gulf Of Mexico Ports [03/19/2022]
- JUST IN - Biden set to ban imports of Russian oil, LNG, and coal without the participation of European allies as soon as today, Bloomberg reports. [03/08/2022]
- Germany Goes Ahead With First LNG Terminal to Cut Dependence on Russian Gas [03/05/2022]
- US, Europe plan for any cutoff of Russian natural gas [01/29/2022]
- Sinopec to hold LNG auction as China's winter heating season nears [01/20/2022]
- US becomes world's top exporter of liquified natural gas [01/05/2022]
- Cargo ships divert gas from China to Britain [12/28/2021]
- LNG Flotilla Carrying U.S. Gas Heading to Europe [12/22/2021]
- US LNG Exports Are Falling At Just the Wrong Time [10/23/2021]
- The 3 Nations Vying For Global Liquefied-Natural-Gas (LNG) Dominance [04/13/2021]
- Biden energy ban an economic hammer to Colorado [02/03/2021]
- EXCLUSIVE: Hunter Biden Audio Confesses Partnership With China 'Spy Chief'... Joe Biden Named As Criminal Case Witness [10/27/2020]
- Can LNG Kill Oil? [02/17/2020]
- Emissions Accomplished -- Trump Wins on Fracking [02/15/2020]
- Two Women Charged with Offenses Related to Pipeline Attacks [10/04/2019]
- U.S. LNG grabs 10% market share as Jan-Aug exports equal 2018 volumes [09/04/2019]
- So much for the lunatic charge that Trump is 'in Putin's pocket' [09/03/2019]
- US Natural Gas Will Soon Run the World [08/03/2019]
- Hunter Biden Admits to Taking Diamond Bribe From Shady Chinese Businessman -- Media Silent [07/02/2019]
- #FoxNews Live: Trump promotes his U.S. energy sector policies in Louisiana [05/14/2019]
- Report: Trump's Motorcade Involved In Crash, No Sign President Is Hurt [05/14/2019]
- Novatek, Repsol Pact for Arctic LNG 2 [04/06/2019]
- Can Summer Save LNG Demand? [03/24/2019]
- Can U.S. Gas Production Keep Up With Demand? [02/14/2019]
- Poland's goal of ditching Russian natural gas bolsters American LNG and Trump's energy agenda [12/24/2018]
- Why Putin's Game Of Russian Roulette With Ukraine Is A Big Deal [11/29/2018]
- First LNG Cargo Sets Sail from Maryland's Cove Point Export Terminal [03/06/2018]
- In New Trend, U.S. Natural Gas Exports Exceeded Imports in 3 of the First 5 Months of 2017 [08/08/2017]
- Rick Perry: 'First-ever' natural gas exports [to northern Europe] offer hedge against Russia [06/10/2017]
- Europe Slams Trump In Public On Climate, Lobbies Him In Private For Natural Gas Exports [06/04/2017]
- Why $25 NatGas Is Possible This Winter [11/08/2016]
- Turkey to transit Russian natural gas to Europe via Turkish Stream pipeline - Erdogan [08/09/2016]
- Gas plant proposal subject of novel suit [04/28/2016]
- THE JACKI DAILY Show! Listen live at 2PM Eastern! [03/27/2016]
- PODCAST: JACKI DAILY SHOW 3/20/16, listen in! [03/21/2016]
- THE JACKI DAILY Show! Listen live at 2PM Eastern! [02/21/2016]
- THE JACKI DAILY Show! Listen live at 2PM Eastern! [02/07/2016]
- Japan And Iran Could Keep a Lid On Oil Price Rally [02/03/2016]
- The Jacki Daily Show! Live at 2PM [01/31/2016]
- Shell transitioning Houston truck fleet from diesel to LNG [01/28/2016]
- Iran Seeks Rapid Reboot for Natural Gas Exports {Europe within two years} [01/27/2016]
- Jacki Daily Show replay: Rep. Sessions GOP Leadership: DC Energy Update; Maguire's Weinstein: [01/18/2016]
- Cheniere delays first Sabine Pass LNG export [01/15/2016]
- CHENIERE'S SABINE PASS PREPARES FOR IMMINENT LNG EXPORT [01/12/2016]
- 10 Key Energy Trends To Watch For In 2016 [01/06/2016]
- Texas shale gas headed for Europe [01/05/2016]
- Natural Gas Exports Are Ramping Up - What Does It Mean For The Commodity? [12/22/2015]
- LNG Glut Worse Than Oil [12/14/2015]
- New York Gov. Andrew Cuomo rejects proposed gas terminal off coast [11/13/2015]
- World's first LNG-powered container ship, the Isla Bella of the Marlin class, begins service [11/02/2015]
- Win Scholarship $-TX Energy Council; Energy in Depth's Everley-UNT's Ozone Study; WV Coal & NatGas [10/26/2015]
- We won't compete with Russia (US origin liquefied natural gas as limited export capacity) [10/26/2015]
- Jacki Daily interview Emil Pena on LNG exports on The Jacki Daily Show [10/14/2015]
- Cheniere Energy prepares Sabine Pass plant for LNG production [10/07/2015]
- Ambitious LNG Project Could Revive Alaska's Fortunes [09/23/2015]
- Hawaiian Electric ponders next move after governor opposes use of LNG: source [09/01/2015]
- Hawaii Gov. Ige reveals opposition to utility LNG import plans [08/28/2015]
- Sanctions Bite Massive Gas Project in Russian Arctic [08/28/2015]
- Commentary: 10 challenges faced by the global LNG market [08/27/2015]
- U.S. Gas Exports: The Pipe Dream [08/05/2015]
- Here's why ocean shipping companies are switching to natural gas [07/23/2015]
- US Senate energy bill to speed LNG exports, clarify SPR sales limits [07/23/2015]
- Exxon Mobil gets DOE approval for wider LNG exports at Alaska terminal [06/02/2015]
- Net imports of natural gas fall to lowest level since 1987 [05/22/2015]
- UGI to build second LNG plant [05/20/2015]
- Feds hand key LNG export license to Cheniere's Corpus Christi project [05/14/2015]
- Panama officials at OTC say expanded canal could be a gateway to LNG business [05/06/2015]
- EIA: The U.S. will be a net natural gas exporter by 2040, even with the most conservative projection [04/29/2015]
- India asks Qatar to cut LNG price by 60% [04/27/2015]
- Floating LNG regasification is used to meet rising natural gas demand in smaller markets [04/27/2015]
- NASSCO launches 'green' containership [04/21/2015]
- Natural gas industry lobbyists ask feds to put LNG projects on fast track [04/17/2015]
- Mack Trucks Updates Its Natural-Gas Powered Semi Tractors [03/10/2015]
- Lithuania signs US deal to replace Russian gas [03/01/2015]
- Deliveries of liquefied natural gas take edge off region's supply gap [02/03/2015]
- Environmentalists are Wrong about Port Ambrose LNG [01/13/2015]
- Lithuania's LNG terminal receives first commercial cargo [12/29/2014]
- Lawmakers meet to discuss LNG projects, public not invited [11/30/2014]
- Natural Gas Vehicles See Steady Growth [11/19/2014]
- Many moving parts, North Slope LNG project for Interior gas supply continues to take shape [11/15/2014]
- Proposed LNG plant aims to fuel drilling rigs, pressure pumpers [10/07/2014]
- Dominion welcomes final FERC approval for Cove Point LNG [09/30/2014]
- What energy exports are doing for Houston's job surge [09/23/2014]
- Poland Plans Gas Hub to Kill Reliance on Russian Energy [09/18/2014]
- Next LNG steps approved {LNG for Alaska consumption, not exports} [09/05/2014]
- Slow Going for Natural-Gas Powered Trucks [08/26/2014]
- Douglas-Westwood: 'Australian LNG - A Lost Cause?' [08/12/2014]
- Companies take a big step toward LNG export plant in Louisiana [08/08/2014]
- Battle of the Fuels: Will Natural Gas Replace Diesel? [08/08/2014]
- US DOE approves Oregon project to export LNG [07/31/2014]
- Qatar spends big on American choppers and missiles [07/15/2014]
- Philippines Considers LNG Import Receiving Options [07/04/2014]
- Advocates See US Gas Exports Spurring Major Job Growth [06/27/2014]
- FERC approves Cameron LNG liquefaction, export project [06/19/2014]
- After Oil, Natural Gas May Be Next On North American Rails [06/16/2014]
- Economics of natural gas don't always add up for fleets [06/13/2014]
- Alaska Voters Hold the Key to the North Slope [05/16/2014]
- Walden presses Obama to stop natural gas export delays [05/08/2014]
- An Overview Of The Global LNG Market And Future Outlook [04/27/2014]
- The next Keystone? Natural gas project draws environmentalist ire [04/23/2014]
- Liquefied natural gas shows potential as a freight locomotive fuel [04/14/2014]
- Liberation Of Europe From Gazprom Due To Nat Gas Exports Is Nonsense, Cheniere CEO [04/11/2014]
- Opponents of natural-gas exports have it all wrong [04/05/2014]
- ZUBRIN: The folly of blocking natural-gas exports [04/01/2014]
- ZUBRIN: The folly of blocking natural-gas exports [04/01/2014]
- How Liquid Natural Gas May Revolutionize Shipping, And Make Goods Cheaper [03/31/2014]
- Can Europe wean itself from Russian natural gas? [03/29/2014]
- Eastern Europe is Pleading for American Made Energy [03/27/2014]
- Message to Moscow? Feds give initial approval for Oregon facility to export natural gas [03/24/2014]
- Obama administration ignores eco-radicals, approves another natural gas export terminal [03/24/2014]
- Texans boost natural gas use for driving, but not for power [03/23/2014]
- Green groups pressure Obama to reject LNG export expansion [03/19/2014]
- FERC issues draft EIS on Freeport LNG's Phase II projects [03/17/2014]
- Would U.S. Natural Gas Exports Put Putin in His Place? [03/14/2014]
- Heed Europe's Plea For U.S. Natural Gas Exports [03/11/2014]
- The Ukraine Crisis Is Bolstering America's Oil And Gas Boom [03/11/2014]
- US gas exports will grow but won't change markets, CEO says [03/05/2014]
- Watson: US Should Move Forward with LNG, Crude Exports [03/05/2014]
- Save the Ukraine By Exporting Natural Gas [03/04/2014]
- He Who Controls the Energy Controls the People [03/02/2014]
- Researchers: Natural gas vehicles will see rapid rise globally through 2023 [02/28/2014]
- Gulf Coast's industrial boom strains labor pool [02/17/2014]
- Smaller companies join move to natural gas vehicles [02/10/2014]
- Natural Gas Locomotives May Prove Cheaper, Cleaner [01/27/2014]
- A Big Fracking Lie (Obama supporters in a panic) [01/22/2014]
- Encana slashing fuel costs by drilling with natural gas [01/22/2014]
- PwC Sees More Shale-Driven Growth in Transportation & Logistics [01/17/2014]
- Alaska Signs Deal To Free Up Natural Gas For Export [01/17/2014]
- Brittany Ferries orders €270m ship [01/14/2014]
- Let The Gas Loose [12/17/2013]
- Utilities Want To Offer Natural Gas Truck Refueling, Competitors Object [12/12/2013]
- Royal Dutch Shell: hull of world's largest floating oil platform launched in South Korea [12/03/2013]
- This Natural Gas Find Could Completely Change the World As We Know It (Israel-Cyprus) [11/03/2013]
- 3 Ways To Play The Natural Gas Engine Rollout [10/30/2013]
- GE Capital and Clean Energy Form Strategic Alliance ... [10/21/2013]
- Syria crisis: Guide to armed and political opposition [10/19/2013]
- {LNG 101} What it is, who uses it and why [10/16/2013]
- Asia wants a piece of U.S. shale gas boom ... [10/15/2013]
- Coming to Railroads soon: Natural gas locomotives [10/09/2013]
- Companies Give Leading LNG Site for Alaska Project [10/08/2013]
- LNG producer will enter Texas market with Dallas-area plant [09/25/2013]
- Japan, Canada close to deal on shale gas export boost [09/22/2013]
- Clean Energy Fuels Gets a Major Vote of Confidence [09/19/2013]
- Commentary: US natural gas exports hit series of roadblocks [09/17/2013]
- US DOE Approves LNG Exports from Dominion's Cove Point [09/12/2013]
- Is The United States Going To Go To War With Syria Over A Natural Gas Pipeline? [09/06/2013]
- Energy Manipulation [08/14/2013]
- Natural gas fuel use could be a long haul, even for a pickup [08/12/2013]
- Japan logged record trade deficit in first half [07/24/2013]
- How Can LNG Take to the Skies? [07/18/2013]
- 10 Points to Consider in the Great Natural Gas Vehicle Debate [07/12/2013]
- Moscow reiterates interest for Cyprus natural gas reserves [07/05/2013]
- India, China Energy War Heats Up [07/02/2013]
- Gazprom Feeling the LNG Heat (Russia) [07/01/2013]
- Sinopec completes Chesapeake deal [06/30/2013]
- World's fastest ferry running on natural gas [06/26/2013]
- Exxon Seeks Approval for Massive Canadian LNG Plan [06/26/2013]
- Cyprus signs LNG plant MoU with Noble, Delek and Avner [06/26/2013]
- Gazprom, Japan group tie on Vladivostok LNG plant [06/23/2013]
- LNG Exports -- First Mover or Laggard? [06/19/2013]
- Clean Energy Releases Fourth Edition of ROAD TO NATURAL GAS [06/17/2013]
- Why we should speed U.S. gas exports [06/16/2013]
- Exxon CEO says delays in gas export permits hurt U.S. [06/13/2013]
- Coming To America: Greater International Investment Could Be Coming To Oil And Gas Midstream Sector [06/10/2013]
- Taking it apart: The US LNG export fight [05/30/2013]
- Exxon Mobil announces plan with Qatar for $10 billion LNG terminal [05/10/2013]
- Natural Gas Boom's Top 3 LNG Exporters: 1st Promising Player, Cheniere Energy [05/05/2013]
- Highest-paid workers driving Shell off Australian shores [04/26/2013]
- Natural gas price more than doubles from 2012 low [04/23/2013]
- Global Impact of North American Shale Gas Boom Forces Qatar to Shift Focus [04/17/2013]
- Shell's Odum: Optimistic on liquefied natural gas for transportation [04/16/2013]
- Commentary: The shale gas revolution demands change on export policy [04/16/2013]
- Shell promotes US natural gas by using it [04/15/2013]
- LNG UPDATE: Global LNG pricing evolves; supply, demand struggle toward balance [04/01/2013]
- Japan Plans LNG Futures Contract [04/01/2013]
- Analysis: Thrifty truckers wary of pricey natural gas vehicles [03/28/2013]
- Natural gas considered for trucking fuel [03/24/2013]
- City of Valdez plans big campaign against gas line [03/22/2013]
- Westport and Clean Energy Co-Marketing Program Helps Companies Ramp Up Natural Gas Transportation... [03/20/2013]
- Chinese firm puts millions into U.S. natural gas stations [03/14/2013]
- Road to natural gas vehicles vexes GM chief [03/13/2013]
- Railway says fuel savings inspired LNG test [03/07/2013]
- First LNG-Fueled Hydraulic Fracturing Completed in Eagle Ford Play [12/12/2012]
- Gas tanker Ob River attempts first winter Arctic crossing [11/30/2012]
- Labor Crunch to Worsen for Australia's Burgeoning LNG Industry [08/20/2012]
- Russia: Gazprom's Shtokman Project Relic of a Past Era [08/12/2012]
- TransCanada seeking interest in Alaska pipeline [08/03/2012]
- Freeport LNG inks deal to sell natural gas to Japanese utilities [08/02/2012]
- AGT: Australia's LNG Industry Lacks Engineers Over 5-Year Period [07/26/2012]
- Baltic LNG Terminals Conditioned by Gas Sector Reform [07/08/2012]
- Global LNG supplies to remain tight through 2015 [06/12/2012]
- Volvo Unveils 13-Liter Natural Gas Engine for North American Market [05/22/2012]
- Excelerate Unveils US Floating Liquefaction Plans {LNG for export} [05/17/2012]
- LNG Exports: To Cap or Not to Cap? [05/16/2012]
- Gas boom may stop at coast of Maryland [04/27/2012]
- LNG exports: A release valve for U.S natural gas [04/23/2012]
- Sabine Liquefaction Project Clears FERC Hurdle {Natural Gas Export} [04/17/2012]
- Highway bill is worth billions to companies owned by Soros, Pickens, Douglas [03/13/2012]
- U.S. Shale Boom Reduces Russian Influence Over European Gas Market [11/26/2011]
- Alaska's gas market is Asia, not North America [11/18/2011]
- Kitimat gets go-ahead {Canada approving the LNG export project} [10/21/2011]
- Utility, refiner form pact to truck North Slope gas [08/08/2011]
- Wood Mac: LNG could pay at $75 oil with state-owned pipeline [08/08/2011]
- Clean Energy up 13% on analyst upgrade [07/13/2011]
- Chesapeake Energy $1B Plan to Break OPEC 'Headlock': CEO [07/12/2011]
- Fukushima nuclear crisis pushing up prices of liquefied natural gas [06/23/2011]
- Sabine Pass gets Energy Department approval for LNG export [05/23/2011]
- ConocoPhillips, Marathon plan to close Alaska LNG plant [02/10/2011]
- More time for exports {Alaska, LNG} [04/17/2010]
- Conoco, Marathon seek renewal of LNG export license in Alaska [04/11/2010]
- Utility boosts plan to truck gas from North Slope to Fairbanks [04/01/2010]
- Columbia River LNG Terminal Plan Hits Ore. DEQ Logjam [02/23/2010]
- Waterborne's Johnson: Tracking the LNG Bubble [02/23/2010]
- Could Al Qaeda Blow Up LNG Tankers on 2/11? [02/03/2010]
- Could Al Qaeda Blow Up LNG Tankers on 2/11? [02/03/2010]
- Latest Risk to Alaska Gas Pipeline: More Gas ( From the lower 48 states ) [01/30/2010]
- Analysis: Major Offshore Project Start-Ups to Watch in 2010 [01/30/2010]
- Mayor seeks to block tankers Wants Yemen gas delivery offshore [01/01/2010]
- U.S. regulator approves Oregon LNG terminal [12/21/2009]
- Does LNG Place America at Risk? [10/21/2009]
- ExxonMobil: Green Company of the Year [08/08/2009]
- Arctic Energy Summit 2007, Anchorage Alaska: Submarine Technologies for Global Energy Security [08/01/2009]
- This Would Be Funny If It Were Not So Scary [06/17/2009]
- Terrorism expert says LNG project lacks safeguards [05/29/2009]
- Long Beach unveils LNG fueling station [04/22/2009]
- Shell, TransCanada lose bid for LNG terminal [04/13/2009]
- Gazprom gets major deal to supply gas to US [04/09/2009]
- First Nations become partners in Canadian pipe to LNG terminal [04/09/2009]
- Shell secures new supplies of Russian gas to sell in Europe [04/09/2009]
- First Sakhalin II LNG cargo loaded for Japan [03/31/2009]
- This year and next critical for many LNG projects: IEA analyst [03/31/2009]
- Global LNG glut set to reverse [03/30/2009]
- Chevron to Buck Downturn with Major Project Developments [03/10/2009]
- LNG terminal owners get creative to counter slowdown [01/31/2009]
- WoodMac: North America will import more LNG [01/16/2009]
- FERC approves Sparrows Point LNG terminal, pipeline [01/16/2009]
- ExxonMobil Technology Makes Breakthrough with World's Largest LNG Carrier [12/17/2008]
- FERC issues final EIS for LNG project near Baltimore [12/09/2008]
- Qatar on Schedule to Double LNG Output by 2010 [12/04/2008]
- Left Coast liberals bash Palin over Alaskan LNG exports [10/23/2008]
- No Oil For America [10/22/2008]
- Russia, Iran and Qatar discuss OPEC-style cartel [10/21/2008]
- Palin Thwarts The Gas Cartel [10/14/2008]
- LNG and Left Coast liberal hypocrisy [09/11/2008]
- Unconventional Natural Gas Resources Boost US Reserves to 118 Years Worth at Current ... Levels [08/12/2008]
- Mr. Frank's Wild River (Congressman Barney Frank's bill -LNG) [07/09/2008]
- Coal-Cap Disaster, For McCain, bad carbon economics could lead to even worse carbon politics [05/28/2008]
- Sempra completes LNG terminal in Baja [05/15/2008]
- Bush threatens veto of Coast Guard bill over LNG security [04/23/2008]
- First tanker docks at new Texas LNG port [04/16/2008]
- Cold cargo is cool with residents as tanker brings LNG [04/12/2008]
- FERC approves US's first floating LNG terminal [03/24/2008]
- Feds OK LNG terminal between N.Y., Conn. [03/20/2008]
- Exxon Mobil aims to put LNG terminal off New Jersey [12/12/2007]
- CA: Process for new LNG terminal starts (convert oil platform for LNG use, 12.6 miles offshore) [10/02/2007]
- DFW - Huge Explosion near Reunion Arena [07/25/2007]
- Schwarzenegger Rejects LNG Terminal Off Southern California Coast (Cabrillo Port) [05/18/2007]
- Iran signs gas deal with Austria's OMV [04/22/2007]
- Iran signs major gas deal with Austria's OMV: reports-(guns or butter er energy deals) [04/21/2007]
- LNG plan is rejected by Coastal Commission (12-0 decision) [04/13/2007]
- Hearing today on LNG project [04/09/2007]
- CA: LNG plant vote looms - Critics assail offshore facility (14 F'n miles offshore) [04/07/2007]
- Los Alamos figures out different way to liquefy natural gas [04/02/2007]
- The case for LNG [04/02/2007]
- Shell drops its plan to build much-reviled offshore LNG terminal [03/30/2007]
- Perry voters narrowly OK $3.6 million deal with LNG developer [03/27/2007]
- LNG land use permit process beginning {Coos Bay, Oregon} [03/23/2007]
- Palin recants port authority endorsement {AK Gas Pipeline} [03/21/2007]
- Who's Afraid of Liquified Natural Gas? [03/09/2007]
- Global LNG market to double by 2010 - PwC [02/28/2007]
- N.B. and Maine political leaders agree to disagree on LNG tanker dispute [02/21/2007]
- LNG plant causes controversy [02/12/2007]
- Iran and South Korea sign $500m LNG contract [02/07/2007]
- New LNG gateways [02/05/2007]
- Shell Defies US Pressure And Signs £5bn Iranian Gas Deal [01/29/2007]
- Poland's CP Energia buys Russian LNG producer [01/25/2007]
- CA: California air quality agency sues state utility officials (SCQAMD sues CPUC over LNG usage) [01/24/2007]
- Long Beach LNG Terminal Axed [01/23/2007]
- Poland hopes to get first LNG shipments from Algeria by 2010-2011, minister says [01/17/2007]
- Poland enter negotiations with Algeria over gas supplies [01/12/2007]
- Energy From Another Backyard [01/04/2007]
- US is urged to delay action on LNG ports [11/09/2006]
- China resumes LNG hunt, at higher prices [11/01/2006]
- Editorial: Choices, choices, choices - Natural gas imports part of balanced solution [10/30/2006]
- Russian prosecutors may launch criminal case over violations at Shell-led energy project [10/28/2006]
- U.S. government to hold LNG forum [10/24/2006]
- Celebrities Protest Malibu Gas Facility [10/22/2006]
- Celebrities, Residents Protest LNG Terminal-(w video at link) [10/22/2006]
- Hundreds protest proposed LNG port-(they make their own hot gas) [10/17/2006]
- Rosneft adds more LNG ideas to Sakhalin gas options [10/16/2006]
- CA: Liquefied gas' future in hands of next governor [10/16/2006]
- Positive energy-(granolas of the world unite against Liquid Natural Gas... ) [10/13/2006]
- El Paso to Build New Pipeline {Nat Gas, Savannah GA, LNG} [10/13/2006]
- Huge Baja Project May Chill Others' LNG Plans [10/09/2006]
- Liquefied gas port plan advances [10/08/2006]
- Gambling on Gas [10/07/2006]
- LNG plans are moving while gas contract stalled [09/22/2006]
- Hollywood A-listers take on BHP Billiton-(looney left dont need LNG gas) [09/21/2006]
- Sabine Pass celebrates start of LNG project [09/19/2006]
- Brosnan Protests Planned Gas Terminal (Clueless Hollyweird Alert) [09/16/2006]
- Mexico to stagger first LNG shipments [09/07/2006]
- Officials Take Another Legal Step To Stop LNG Facility [09/07/2006]
- County supervisor blasts LNG proposal [09/07/2006]
- Port Freeport commissioners tour Freeport LNG {Texas} [09/07/2006]
- AGPA aims for early start {LNG Alaska} [09/02/2006]
- CA: Assembly panel kills bill requiring LNG site rankings - SB426 [09/01/2006]
- Factions split over LNG 'advisory' vote {Oregon} [09/01/2006]
- {Maryland} State to let dredge deal die to stop LNG terminal [09/01/2006]
- Betting Billions on Liquefied Natural Gas [08/29/2006]
- BP backs away from Texas LNG project [08/28/2006]
- Gas line authority renews its pitch {Alaska LNG} [08/27/2006]
- The truth about LNG {Alaska} [08/27/2006]
- CA: Bill to rank LNG plans shunted to committee - Supporters say state may lose power to U.S. [08/26/2006]
- Security breach reported at Lynn LNG facility [08/23/2006]
- The Russians are coming........................ Go ask the Ukraines what they would do........... [08/17/2006]
- Singapore to build its first LNG terminal to diversify energy sources [08/07/2006]
- FERC Nominee Spitzer Cautions Against Dependence on LNG-(LNG - liquid natural gas) [07/04/2006]
- Gas Tankers Prompt Tight Security [06/19/2006]
- Baxley wants Riley to delay decision on LNG terminal [06/01/2006]
- Blanco vetoes natural gas port [05/06/2006]
- Governor running out of time to decide on LNG project [05/03/2006]
- India-Iran LNG deal in peril [Pipeline deal in trouble.] [05/03/2006]
- Malibu bares anger at LNG meeting-(Liquid Natural Gas in peace loving cali) [04/27/2006]
- CA: Study shows gas release could result in miles-long fireball (proposed LNG Offshore terminal) [04/18/2006]
- Australian firm proposes LNG terminal in ocean off Malibu coast (22 miles offshore) [03/16/2006]
- CA: The politics of LNG - Negotiations and elections make a timely mixture. [03/13/2006]
- China, Iran Near Huge Oil Deal [02/17/2006]
- Iran to India: LNG price we signed on is no longer valid [01/31/2006]
- Shell declares hand, Focused on offshore in Alaska [01/28/2006]
- Natural Gasbags (WSJ Editorial) [01/09/2006]
- Iran and Russia to cooperate on pipeline [12/11/2005]
- China's Sinopec says no final agreement yet with Iran on LNG purchase [11/10/2005]
- LNG debate goes public (FERC opens public comment phase re: LNG at Long Beach) [10/11/2005]
- CA: Report says natural gas project at port isn't environmental risk (FERC & Long Beach LNG) [10/08/2005]
- Shell looks to Bristol Bay {Alaska} for new development [10/08/2005]
- IRAN COULD RUN OUT OF OIL RESERVES IN 9 DECADES: OFFICIAL [10/04/2005]
- LNG deal with India is off: Iran [09/27/2005]
- UPDATE: Gazprom tanker makes first liquefied natural gas delivery to U.S. [09/02/2005]
- LNG: Harbor Commission has final say (Long Beach) [08/22/2005]
- CA: LNG terminal safety, meth top Tuesday council agenda [08/15/2005]
- Congress prepared to move on LNG [07/27/2005]
- New Terrorist Bomb Attack-- Thirteen Injured in Trinidad Explosion [07/11/2005]
- Officials OK LNG facilities in Texas, Massachusetts [06/30/2005]
- CA: Governor wants LNG site off Oxnard (floating platform miles offshore) [06/24/2005]
- Senate says LNG siting should be federal decision [06/23/2005]
- Senate agrees to give regulators power on liquefied natural gas facilities (FERC to have final say) [06/22/2005]
- Iran pipeline may be extended to China: Aiyar [06/12/2005]
- Senators push for more state authority over LNG permits (Teddy , DiFi and JF'nK) [06/09/2005]
- CA: Long Beach approves reopening talks over natural gas terminal [06/08/2005]
- FERC: Exxon project won't harm environment(liquified natural gas terminals planned for Gulf coast) [06/03/2005]
- Schwarzenegger, 5 other governors press senators on LNG terminals [05/25/2005]
- Anti-American fossil liberals rally against cleaner burning LNG fuel [05/20/2005]
- CA: Governor cautions fed - Letter supports state's right to limit LNG terminals. [05/19/2005]
- CA: ConocoPhillips, Mitsubishi to Develop LNG Terminal (Long Beach) [05/18/2005]
- Delays could kill Arctic Canada pipeline: report [05/11/2005]
- News about LNG terminals is what somebody wants to suppress [05/06/2005]
- Environmentalists challenge planned gas terminal off Baja coast (birds at risk,NAFTA appeal made) [05/03/2005]
- WSJ: Unnatural Gas Prices -- The U.S. economy can't run on wind power. [05/03/2005]
- LNG will Boost the Economy -- The Terminals Will Compete with Enron's Transwestern Pipeline [05/01/2005]
- LNG Means Relatively LOW NATURAL GAS Prices [04/20/2005]
- LNG Import Terminals Will Not Result in High Natural Gas Prices [04/17/2005]
- CA: Decision means natural gas prices would stay high [04/15/2005]
- House Panel Working on Energy Bill [04/12/2005]
- Congress wants FERC to rule on LNG terminals [04/07/2005]
- CA: Inquiry into Sempra LNG project launched [04/02/2005]
- "We Need a Reprieve from Thomas Elias - Thomas Elias's Journalistic Crime against Logic ..." [03/27/2005]
- OPEC-like cartel in natural gas not impossible-() [01/25/2005]
- The Growing Beijing/Tehran Axis [01/19/2005]
- Iran-Pakistan-India pipeline: the Baloch wildcard [01/13/2005]
- CA: Sempra Awards LNG Contracts ( to be built south of San Diego ) [01/04/2005]
- Mexican Ecologists Protest U.S. Gas Plant on Coast [12/10/2004]
- CA: Bill rider may hurt state on LNG issue (PUC vs. FERC) [12/02/2004]
- Shell, Sempra Receive Permits for Baja Plant ( LNG Gas from Russia ) [09/30/2004]
- Maine Indian tribe OKs gas terminal (LNG) [08/19/2004]
- Strait of Fire: How it could happen (fiction) [08/10/2004]
- CA: State officials toured overseas gas sites with energy execs [08/02/2004]
- The Great Refinery Shortage [06/08/2004]
- Howard hits LA for gasbag with Arnie [06/02/2004]
- LNG tanker stowaways may have terror tie [04/29/2004]
- Liquefied natural gas -- Not in anyone's backyard [04/02/2004]
- U.S. asserts jurisdiction over planned (California) LNG site [03/25/2004]
- Port authority may have LNG buyer [02/04/2004]
- What the American Petroleum Institute Has to Say About Natural Gas Futures [08/05/2003]
- Homeowners in Mexico press their opposition to new terminals [11/11/2002]
- California: Big play, Big risks - companies gamble billions on LNG projects worldwide [06/16/2002]
13
posted on
09/27/2022 2:39:30 PM PDT
by
SunkenCiv
(Imagine an imaginary menagerie manager imagining managing an imaginary menagerie.)
Disclaimer:
Opinions posted on Free Republic are those of the individual
posters and do not necessarily represent the opinion of Free Republic or its
management. All materials posted herein are protected by copyright law and the
exemption for fair use of copyrighted works.
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson