Free Republic
Browse · Search
General/Chat
Topics · Post Article

Skip to comments.

Einstein Was Right, Again: Novel Experiment Proves Antigravity Doesn’t Exist
www.inverse.com ^ | SEP. 27, 2023 | BY KIONA SMITH

Posted on 10/06/2023 7:57:56 AM PDT by Red Badger

Dreams of a world powered by antigravity got quashed by a particle physics today.

~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~

It turns out that Einstein was right yet again. A recent experiment just proved that antigravity doesn’t exist and we probably won’t ever get to use antimatter to levitate or build a perpetual motion machine or power warp drives (sorry, Star Trek).

Antimatter itself is very real. Made of particles that mostly behave like regular matter, but their electrical charges are reversed, an anti-proton looks just like a proton but has a negative charge, while an anti-electron (or positron) looks and moves just like an electron but has a positive charge. When a bit of antimatter bumps into a bit of matter, they explode so dramatically that all of their combined mass is converted into energy.

Now we know that matter and antimatter are drawn toward each other — not pushed apart — by gravity. Physicist Albert Einstein predicted this in his theory of general relativity years before the first positron was discovered, but Aarhus University physicist Emma Anderson and her colleagues at ALPHA (the Antihydrogen Laser Physics Apparatus) just tested the theory by watching atoms of anti-hydrogen — a single anti-electron orbiting an anti-proton — fall downward under the pull of Earth’s gravity.

The researchers recently published their work in the journal Nature.

AU REVOIR, ANTIGRAVITY

In a nutshell, Anderson and her colleagues dropped atoms of antihydrogen down a tube, and the atoms fell downward thanks to gravity. That sounds simple, and in fact, it’s exactly what Einstein predicted would happen — but it hadn’t been done before. Until now, there was a lingering chance that antimatter wouldn’t feel the tug of Earth’s gravity, or that matter and antimatter actually experienced a sort of antigravity, pushing each other apart.

To make anti-hydrogen, you need to combine positrons and anti-protons. Anti-protons are produced in high-energy particle collisions, then slowed down in what's called an antiproton decelerator at CERN (which is also home to the Large Hadron Collider). Positrons come from radioactive decay of certain chemical elements, like potassium.

Once you have the antimatter, you face the challenge of working with something that will disappear if it touches even another atom of ordinary matter. The team used an eight-pole magnet to keep antihydrogen atoms swirling along the magnetic field lines and away from the deadly walls of the container. Anti-atoms with enough energy (anti-atoms that were moving fast enough, in other words) could still escape, but slower ones would be trapped inside the magnetic field.

This illustration shows what anti-hydrogen atoms falling through the magnetic trap might look like if we could actually see them. - NATIONAL SCIENCE FOUNDATION

When the researchers turned their tube of captured antimatter vertically, they found that the atoms moving downward along the magnetic field lines sped up thanks to the added pull of gravity; the atoms moving upward slowed down, also thanks to gravity trying to pull them Earthward. Anderson and her colleagues couldn’t actually watch the anti-atoms in action, of course, but their instruments counted the tiny flashes of energy every time an anti-hydrogen atom, pulled downward by gravity, gained enough speed to punch through the magnetic field at the bottom of the container and escape, annihilating itself and an unfortunate atom of regular matter in the process.

“To do the experiment, you're actually just turning down the current that makes the magnetic field,” Hangst tells Inverse. “You have a cloud of [anti-hydrogen atoms] bouncing around, and you let them go.”

When that happened, about 80 percent of the anti-hydrogen atoms fell toward Earth. The rest, about 20 percent, were still bouncing upward fast enough to keep going. That’s pretty much the result you’d expect from a tiny cluster of regular hydrogen atoms bouncing around in a magnetic field, too.

That suggests that matter and antimatter both feel the pull of Earth’s gravity in the same way, which means matter and antimatter are attracted, not repelled, by each other’s gravity. In other words, the experiment confirmed that matter and antimatter are drawn together, just like all the other mass in the universe, regardless of their weird properties.

“If you walk down the halls of the department and ask the physicists, they would all say that this result is not the least bit surprising, but most of them will also say that the experiment had to be done because you can never be sure,” says University of California at Berkeley physicist Jonathan Wurtele, a coauthor of the study, in a recent statement. “You don’t want to be the kind of stupid that you don’t do an experiment that explores possibly new physics because you thought you knew the answer, and then it ends up being something different.”

WHERE’S ALL THE ANTIMATTER?

While we can’t use antimatter to levitate or power a perpetual motion machine, we also can’t blame antigravity for shoving all the antimatter out of the universe we see around us, which would have been a convenient way to explain the one prediction of Einstein’s that antimatter definitely doesn’t seem to obey.

According to general relativity, antimatter and matter should exist in equal amounts. But there’s almost no antimatter in the universe, or at least anywhere in the universe we can see and measure. And that raises important questions, like where the heck did it all go?

One idea was that shortly after the Big Bang, matter and antimatter basically gave each other a giant shove apart, separating each other once and for all except for a few tiny, scattered particles. But Anderson and her colleagues’ experiment proves that’s just not how antimatter works, leaving physicists with another big mystery to solve.

WHAT’S NEXT

By varying the strength of the magnetic field — and thus varying how fast anti-atoms had to move in order to punch through it and escape — Anderson and her colleagues managed to measure how much the pull of gravity accelerated the antimatter. The answer turned out to be around 32 feet per second (per second), which is roughly how much Earth’s gravity accelerates ordinary falling matter, too.

One of the next steps is to measure that even more precisely to make sure there’s not really any small difference in how much antimatter accelerates as it falls downward. In other words, that it feels gravity’s pull just as strongly as regular matter, not more or less.

But for now, Anderson and her colleagues are focused on studying how antimatter interacts with radiation. If Einstein’s predictions are correct, anti-hydrogen should absorb, emit, and reflect the same spectrum of light as regular hydrogen — so Anderson and her colleagues will spend the next year or so zapping antimatter with lasers and microwaves to find out.


TOPICS: Astronomy; History; Military/Veterans; Science; Sports; Weird Stuff
KEYWORDS: antigravity; antimatter; astronomy; einstein; flt; ftl; kionasmith; levitation; particlephysics; perpetualmotion; physics; podkletnov; science; scifi; startrek; starwars; stringtheory; warpdrives; wboopi
Navigation: use the links below to view more comments.
first previous 1-20, 21-40, 41-60 last
To: Leaning Right

If there is no such thing as antigravity, what causes my cow to occasionally fly up into the air?

Aliens are stealing them.


41 posted on 10/06/2023 9:43:55 AM PDT by telescope115 (I NEED MY SPACE!!! 🔭)
[ Post Reply | Private Reply | To 9 | View Replies]

To: Ultra Sonic 007

Yeah the flat earthers definitely may have contributed to my inability to detect sarcasm when people post nonsense on science topics.


42 posted on 10/06/2023 9:45:41 AM PDT by Boogieman
[ Post Reply | Private Reply | To 40 | View Replies]

To: adorno; Boogieman
Still, it's very presumptuous for scientists to believe that anti-gravity is either an up or down force. It could be a sideways force movement. ;) Which way is up? In the universe, who knows?

Gravity as a force is determined by the mass of objects. Although it's no longer considered as precise as the theory of general relativity, Newton's law of universal gravitation still suffices in general for most purposes to help clarify how gravitational force between two objects occurs. (And we know there's merit to it, because Newton's law was used to determine the existence of a planet beyond Uranus in 1821, purely due to the fact that Uranus's observed orbit did not behave according to mathematical expectations. It was hypothesized that a sufficiently large planet existed beyond Uranus that was perturbing its orbit; lo and behold, Neptune was eventually discovered in 1846.)

In our particular case, 'up' is just a frame of reference we use relative to our position on Earth, because the mass of Earth overwhelms all other objects within our immediate vicinity. As such, the gravitational force exerted upon us by Earth 'pulls' us toward it. 'Anti-gravity', in this case, would be an inverted reaction between matter and antimatter, in the sense that gravitational interactions would not behave the same as they otherwise would. (In other words, it would not be a 'sideways force', but a lack of force altogether.)

If anti-gravity (as hypothesized for the purposes of the described experiment) existed, then antimatter would not be attracted by the mass of Earth (being made of matter), and would instead behave more or less randomly (since there aren't many objects made of pure anti-mass within the vicinity). However, based on the experiment, anti-matter behaved just like regular matter in terms of gravitational interaction, as it all was attracted in the direction of the greatest gravitational force within the proverbial neighborhood: namely, the Earth itself.

43 posted on 10/06/2023 9:52:58 AM PDT by Ultra Sonic 007 (There is nothing new under the sun.)
[ Post Reply | Private Reply | To 39 | View Replies]

To: Red Badger

This is kind of a good thing.

If you had an antigravity device, but it attracted antimatter to itself, seems like it would then be a pretty useless device as it would pretty quickly be annihilated.


44 posted on 10/06/2023 10:26:48 AM PDT by chrisser (I lost my vaccine card in a tragic boating accident.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Boogieman

Then wouldn’t Relativity tacitly support the notion of contra-gravity where the large mass is perceived to be moving towards the smaller mass? I would expect gravity not to be a quality/dimension of Relativity, but this topic is many decades old in my distant memory. All I recall is man walking inside a train that’s passing a platform — or something like that.


45 posted on 10/06/2023 10:33:26 AM PDT by Gene Eric (Don't be a statist!)
[ Post Reply | Private Reply | To 34 | View Replies]

To: Red Badger
Yup, I agree. It could just as easily be said to undermine Einstein, rather than, as the breathless headline claims, prove he was right.

46 posted on 10/06/2023 10:35:47 AM PDT by SunkenCiv (Putin should skip ahead to where he kills himself in the bunker.)
[ Post Reply | Private Reply | To 23 | View Replies]

To: Gene Eric

“Then wouldn’t Relativity tacitly support the notion of contra-gravity where the large mass is perceived to be moving towards the smaller mass?”

No, because both masses are still attracting each other, so it’s just gravity, whether you look at it from a reference of you falling towards the earth or the earth falling towards you.

“All I recall is man walking inside a train that’s passing a platform — or something like that.”

The basic idea is that the laws of physics remain the same no matter what frame of reference you choose to view things from. So if there is no anti-gravity in one reference frame, there can’t be anti-gravity simply created as an effect of switching to another reference frame.


47 posted on 10/06/2023 10:41:26 AM PDT by Boogieman
[ Post Reply | Private Reply | To 45 | View Replies]

To: Red Badger

Awesome experiment...
Awesome result...

Albert rocks!
The more things change, the more they stay the same...


48 posted on 10/06/2023 10:50:14 AM PDT by SuperLuminal (Where is the next Sam Adams when we so desperately need him)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Magnum44

Thank you, my daughter will appreciate this meme as much as I do 😆


49 posted on 10/06/2023 10:55:38 AM PDT by Spacetrucker (George Washington didn't use his freedom of speech to defeat the British - HE SHOT THEM .. WITH GUNS)
[ Post Reply | Private Reply | To 10 | View Replies]

To: Magnum44

BTTT!!!


50 posted on 10/06/2023 11:02:19 AM PDT by musicman (The future is just a collection of successive nows.)
[ Post Reply | Private Reply | To 10 | View Replies]

To: Red Badger

Gravity is not a traditional force, it’s a distortion of space-time.

Magnetism is a force but has no energy on its own.. it is a good way to convert energy from one form to another i.e. motion to electrical current.

If you could create a sheet of material that could block gravity or magnetism then you would have a perpetual motion machine... it just ain’t possible. It is as silly as the notion of pulling yourself up by the bootstraps...lol

As an aside, the best vehicle that can possibly be made given the current state of technology is a diesel-electric.
Purely battery powered cars await a breakthrough in battery technology that is not yet in sight (compact super-capacitor batteries of small size/weight with enormous capacity and rapid charge times)

A small, clean diesel drives an efficient generator to charge the batteries. The batteries drive the brushless motors in the wheel hubs. No normal braking system required as magnetic braking is excellent, no transmission needed, massive acceleration possible for short durations... no problems running a heater in winter or air conditioning in summer. No waiting to charge your car, it charges itself. You can drive on electric only for quite a few miles to cut pollution inside cities. Diesel is far safer in an accident compared to gasoline - much less danger of fire... i.e. The gas powered Sherman tank was a burning joke compared to German diesel tanks of WW2


51 posted on 10/06/2023 11:13:15 AM PDT by Bobalu (The political prosecution of Donald Trump marks the official end of US democracy.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Red Badger

Dark energy

I’m surrounded by it

Help!

I miss baryonic company


52 posted on 10/06/2023 11:14:10 AM PDT by wardaddy (Why so many nevertrumpers with early sign ups and no posting history till now? Zot them PTB)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Bobalu

https://en.wikipedia.org/wiki/Mu-metal


53 posted on 10/06/2023 11:15:12 AM PDT by Red Badger (Homeless veterans camp in the streets while illegal aliens are put up in hotels.....................)
[ Post Reply | Private Reply | To 51 | View Replies]

To: Red Badger

Dark energy

I’m surrounded by it

Help!

I miss baryonic company


54 posted on 10/06/2023 11:15:20 AM PDT by wardaddy (Why so many nevertrumpers with early sign ups and no posting history till now? Zot them PTB)
[ Post Reply | Private Reply | To 1 | View Replies]

To: wardaddy

That’s odd.................


55 posted on 10/06/2023 11:20:03 AM PDT by Red Badger (Homeless veterans camp in the streets while illegal aliens are put up in hotels.....................)
[ Post Reply | Private Reply | To 52 | View Replies]

To: Boogieman

Appreciated :)


56 posted on 10/06/2023 11:35:44 AM PDT by Gene Eric (Don't be a statist!)
[ Post Reply | Private Reply | To 47 | View Replies]

To: Red Badger

hysteresis loss and other considerations...

The idea of using Mu-metal to create a magnetic perpetual motion device is as silly as the notion of a flat Earth.

Never can such a device produce even the slightest amount of energy gain... it is always losing energy.

As far as energy production, all energy on the Earth comes from stars... our nearest star, Sol is a gigantic hydrogen-fusion source. If we can engineer a safe fusion reactor we will have virtually limitless energy. Fusion is the best energy production we can conceive of at this time... but even fusion power is not something-for-nothing, it is NOT a perpetual motion system.


57 posted on 10/06/2023 11:37:35 AM PDT by Bobalu (The political prosecution of Donald Trump marks the official end of US democracy.)
[ Post Reply | Private Reply | To 53 | View Replies]

To: Larry Lucido
Somebody has be experiencing abstinence.


58 posted on 10/06/2023 12:11:07 PM PDT by Gamecock ("The prosperity gospel is exactly like marrying someone for their money." -Sean Demars)
[ Post Reply | Private Reply | To 14 | View Replies]

To: Magnum44

Borrowing that!


59 posted on 10/06/2023 9:26:05 PM PDT by Redcitizen
[ Post Reply | Private Reply | To 10 | View Replies]

To: Red Badger

Thank you for the article.


60 posted on 10/07/2023 2:33:29 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 1 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20, 21-40, 41-60 last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
General/Chat
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson