Free Republic
Browse · Search
General/Chat
Topics · Post Article

Skip to comments.

Magical equation unites quantum physics, Einstein’s general relativity in a first
Intersting engineering ^ | 09/07/2024 | Rupendra Brahambhatt

Posted on 09/08/2024 8:54:56 AM PDT by BenLurkin

“We proved that the Einstein field equation from general relativity is actually a relativistic quantum mechanical equation,” the researchers note in their study.

In simple words, this new framework connects the science that governs the macroscopic world with that of the microscopic world.

Therefore, it has the potential to explain every physical phenomenon known to humanity ranging from the mysterious dark matter in space to the photons emitted by your phone’s flashlight.

“To date, no globally accepted theory has been proposed to explain all physical observations,” the researchers added. They claim that their theory can challenge the foundations of physics and change our understanding of the universe.

General relativity works well for large-scale objects, while quantum physics accurately describes microscopic phenomena, but what’s the need to unite them? Well, there are two big reasons for that. First, combining these would provide a complete understanding of the universe across all scales.

This is important because many concepts such as black holes or the Big Bang are probably results of the conditions where both quantum physics and general relativity played a role. Understanding them requires a theory that integrates both.

Second, one can not fully understand the science behind quantum gravity, Hawking radiation, string theory, and various other phenomena without connecting the dots between the theory of general relativity and quantum physics.

To link them, the researchers developed a mathematical framework that “Redefined the mass and charge of leptons (fundamental particles) in terms of the interactions between the energy of the field and the curvature of the spacetime.”

“The obtained equation is covariant in space-time and invariant with respect to any Planck scale. Therefore, the constants of the universe can be reduced to only two quantities: Planck length and Planck time,” the researchers note.

(Excerpt) Read more at interestingengineering.com ...


TOPICS: Astronomy; Science
KEYWORDS: astronomy; astrophysics; bigbang; einstein; generalrelativity; gut; physics; plank; quantummechanics; quantumphysics; science; steadystate; stringtheory; unifiedfield; wboopi
Navigation: use the links below to view more comments.
first 1-2021-33 next last

1 posted on 09/08/2024 8:54:56 AM PDT by BenLurkin
[ Post Reply | Private Reply | View Replies]

To: BenLurkin

https://heim-theory.com/wp-content/uploads/2021/02/Illobrand_von_Ludwiger-The_New_Worldview_of_the_Physicist_Burkhard_Heim.pdf

Burkhard Heim: Been there, done that.


2 posted on 09/08/2024 9:02:39 AM PDT by SubMareener (Save us from Quarterly Freepathons! Become a MONTHLY DONOR)
[ Post Reply | Private Reply | To 1 | View Replies]

To: SunkenCiv
The obtained equation is covariant in space-time and invariant with respect to any Planck scale.


3 posted on 09/08/2024 9:03:52 AM PDT by BenLurkin (The above is not a statement of fact. It is either opinion, or satire, or both.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: BenLurkin

I have more than a passing interest in physics. But the author never bothers to say who the researchers are, or where they work. They are just “the researchers”. I find that quite odd. Is the author just sloppy?

There are links in the article. The links lead to very technical stuff that I can follow, but will require more coffee.


4 posted on 09/08/2024 9:07:40 AM PDT by Leaning Right (The steal is real.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: BenLurkin

5 posted on 09/08/2024 9:08:27 AM PDT by dfwgator (Endut! Hoch Hech!)
[ Post Reply | Private Reply | To 1 | View Replies]

To: BenLurkin

Yes, you have the quantum for the micro world, and you have relativity for our world. But what about for the macro world? The macro world would be the way things work on the very large scale. An analogy would be, if we existed in the micro level with the quantum world, what would be the world of relativity? It would be one size larger than our world.

Some might say there are no laws pertaining to a macro world. How can we know for sure?


6 posted on 09/08/2024 9:11:49 AM PDT by BEJ
[ Post Reply | Private Reply | To 1 | View Replies]

To: Leaning Right

It’s just Indian clickbait with a lotta geewhiz BS that’s old news.


7 posted on 09/08/2024 9:12:07 AM PDT by Regulator (It's fraud, Jim)
[ Post Reply | Private Reply | To 4 | View Replies]

To: BenLurkin; 6SJ7; AdmSmith; AFPhys; Arkinsaw; allmost; aristotleman; autumnraine; bajabaja; ...
Thanks BenLurkin.


· List topics · post a topic · subscribe · Google ·

8 posted on 09/08/2024 9:18:29 AM PDT by SunkenCiv (Putin should skip ahead to where he kills himself in the bunker.)
[ Post Reply | Private Reply | View Replies]

To: BenLurkin

Worried about physics when a fungus is about to destroy the world’s banana crop? Get real.


9 posted on 09/08/2024 9:23:02 AM PDT by Fungi
[ Post Reply | Private Reply | To 1 | View Replies]

To: Fungi

“Nevermind that s___, Here Comes Mongo!”


10 posted on 09/08/2024 9:24:11 AM PDT by dfwgator (Endut! Hoch Hech!)
[ Post Reply | Private Reply | To 9 | View Replies]

To: Fungi

Yup. The Banana Famine is upon us and the Strategic Banana Reserve’s just about tapped out. And all these guys can talk about is the fine structure of the universe.


11 posted on 09/08/2024 9:34:02 AM PDT by Billthedrill
[ Post Reply | Private Reply | To 9 | View Replies]

To: Fungi

> Worried about physics when a fungus is about to destroy the world’s banana crop? <

Yeah, I miss the days when physicists did something practical, like maybe working on a better way to transmit power over long distances.

Now they spend (waste?) all their time, money, and effort investigating things like string theory. By the way, there is no hard experimental evidence for string theory at all. Yet it’s a big deal. Kinda like chasing after imaginary unicorns because someone drew a picture of one.

Side point: I taught college freshman physics for a time. But I knew I had no future in college teaching. As you can see from above, I have the wrong attitude.


12 posted on 09/08/2024 9:42:23 AM PDT by Leaning Right (The steal is real.)
[ Post Reply | Private Reply | To 9 | View Replies]

To: BenLurkin; SunkenCiv
“The masses of electrons, muons, and tau can be explained by the different curvatures of universe, galaxy, and solar system, respectively.”

I say as Richard Feynman would have said: BS!

13 posted on 09/08/2024 9:47:55 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 1 | View Replies]

To: BenLurkin
IMG-1141
14 posted on 09/08/2024 10:14:51 AM PDT by broken_clock (Go Trump! Still praying.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: BenLurkin
In Medieval times the Holy Grail of understanding everything was the Philosophers Stone. Issac Newton himself pursued Alchemy in trying to find it. I mention this because the modern equivalent is the Unified Grand Theory of Everything. The attempt to create some theory that united Quantum Mechanics with Einstein's General Relativity is a pursuit over a century old now. If this paper succeeds a Nobel Prize in Physics will be well earned. ( Even though the Nobel Peace Prize is worth about as much as a Cracker Jack prize)
15 posted on 09/08/2024 10:19:56 AM PDT by Nateman (Democrats did not strive for fraud friendly voting merely to continue honest elections.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Leaning Right
Here is a link to the actual paper.
16 posted on 09/08/2024 10:35:09 AM PDT by Nateman (Democrats did not strive for fraud friendly voting merely to continue honest elections.)
[ Post Reply | Private Reply | To 4 | View Replies]

To: BenLurkin

there are a couple quite plausible theoretical connections between quantum field theory and Einstein’s theory of general relativity. the maths apparently work out pretty well. we await some verification, experimental validation...

(which will then certainly result in Nobel prizes, this is somewhat analogous to how Bell’s Theorum questioning local causality and thus Einstein’s firm gut feelings about the matter ... did not result in any Nobel prizes until there was experimental evidence for it years later)


17 posted on 09/08/2024 10:46:45 AM PDT by faithhopecharity ("Politicians aren't born, they're excreted." Marcus Tullius Cicero (106 to 43 BCE))
[ Post Reply | Private Reply | To 1 | View Replies]

To: BenLurkin

So now, what use will mad scientists employed by Bill Gates, Klaus Schwabb, George Soros & Noel Yuval Harari make of this, to afflict billions of ordinary people who just want to mind their own business & be left alone?


18 posted on 09/08/2024 10:52:50 AM PDT by CharlesOConnell (CharlesOConnell)
[ Post Reply | Private Reply | To 1 | View Replies]

To: BenLurkin

Kamala H. is a co-author of this delirium...


19 posted on 09/08/2024 10:54:57 AM PDT by SuperLuminal ( Where is Samuel Adams when we so desperately need him)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Fungi

if quantum fungus, then forget it


20 posted on 09/08/2024 11:16:06 AM PDT by Gene Eric (Don't be a statist! )
[ Post Reply | Private Reply | To 9 | View Replies]


Navigation: use the links below to view more comments.
first 1-2021-33 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
General/Chat
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson