New Study Shows Tyrannosaurus Rex Evolved Advanced Bird-Like Binocular Vision

Science News Online ^ | June 26 2006 | Eric Jbaffe

[Al Simmons]

In the 1993 movie Jurassic Park, one human character tells another that a Tyrannosaurus rex can't see them if they don't move, even though the beast is right in front of them. Now, a scientist reports that T. rex had some of the best vision in animal history. This sensory prowess strengthens arguments for T. rex's role as predator instead of scavenger.

Scientists had some evidence from measurements of T. rex skulls that the animal could see well. Recently, Kent A. Stevens of the University of Oregon in Eugene went further.

He used facial models of seven types of dinosaurs to reconstruct their binocular range, the area viewed simultaneously by both eyes. The wider an animal's binocular range, the better its depth perception and capacity to distinguish objectseven those that are motionless or camouflaged.

T. rex had a binocular range of 55, which is wider than that of modern hawks, Stevens reports in the summer Journal of Vertebrate Paleontology. Moreover, over the millennia, T. rex evolved features that improved its vision: Its snout grew lower and narrower, cheek grooves cleared its sight lines, and its eyeballs enlarged. ...

Stevens also considered visual acuity and limiting far pointthe greatest distance at which objects remain distinct. For these vision tests, he took the known optics of reptiles and birds, ranging from the poor-sighted crocodile to the exceptional eagle, and adjusted them to see how they would perform inside an eye as large as that of T. rex. "With the size of its eyeballs, it couldn't help but have excellent vision," Stevens says.

He found that T. rex might have had visual acuity as much as 13 times that of people. By comparison, an eagle's acuity is 3.6 times that of a person.

b

T. rex might also have had a limiting far point of 6 kilometers, compared with the human far point of 1.6 km. These are best-case estimates, Stevens says, but even toward the cautious end of the scale, T. rex still displays better vision than what's needed for scavenging.

The vision argument takes the scavenger-versus-predator debate in a new direction. The debate had focused on whether T. rex's legs and teeth made it better suited for either lifestyle.

Stevens notes that visual ranges in hunting birds and snapping turtles typically are 20 wider than those in grain-eating birds and herbivorous turtles.

In modern animals, predators have better binocular vision than scavengers do, agrees Thomas R. Holtz Jr. of the University of Maryland at College Park. Binocular vision "almost certainly was a predatory adaptation," he says.

But a scavenging T. rex could have inherited its vision from predatory ancestors, says Jack Horner, curator of paleontology at the Museum of the Rockies in Bozeman, Mont. "It isn't a characteristic that was likely to hinder the scavenging abilities of T. rex and therefore wasn't selected out of the population," Horner says.

Stevens says the unconvincing scene in Jurassic Park inspired him to examine T. rex's vision because, with its "very sophisticated visual apparatus," the dinosaur couldn't possibly miss people so close by. Sight aside, says Stevens, "if you're sweating in fear 1 inch from the nostrils of the T. rex, it would figure out you were there anyway."

Stevens, K.A. 2006. Binocular vision in theropod dinosaurs. Journal of Vertebrate Paleontology 26(June):321-330.

[Al Simmons]

That was a wisecrack. I am not qualified to take part in a discussion of higher math because, owing to the overdevelopment of the other parts of my brain, the math part got squeezed out.....

*LOL*

BTW, are you in Europe or do you have the same insomnia I've currently got????

[DanDenDar]

Incorrect. Nice of you to just join up to post such rubbish, though.

It's a shame that you chose to become personal so quickly . How long ago I signed up does not affect whether I am right or wrong.

AA is 1 base pair out of 1953 in the bacteria gene under debate.

A does not pair with A. A pairs with T. And when we list a genetic sequence, we don't usually give the complementary bases, because anyone who knows the rudiments can figure out what the complementary strand is. So AA pairs with TT.

You evolutionists need to bone up on simple math.

If you don't understand the structure of DNA, you are going to make mistakes even before you get to doing any math.

By the way, because pairs such as AG & GA could be seen as duplicates, the formula that I gave in the earlier post for 3^1953 was used instead of 6^1953.

DNA strands have a direction. They are by convention given from 5' end to 3' end. So AG is not the same as GA, and they can't be 'seen as duplicates', unless you don't understand the chemical structure of DNA.

I hope you don't think it's impolite for me to suggest that you should learn some elementary molecular biology before you try to argue about it.

[Southack]

Let's say we have 2 bases, and the original sequence is AA. Then the list of sequences accessible by a single point mutation is (AT, AG, AC, TA, GA, CA). That's six, which is 3*2, not 3^2.

If we have three bases, starting from AAA, we get (AAT, AAG, AAC, ATA, AGA, ACA, TAA, GAA, CAA). That's 3*3 = 9, not 3^3 = 27. And so on. You do know * is a multiplication sign, right?
617 posted on 07/07/2006 9:43:05 PM CDT by DanDenDar

 

 

A does not pair with A. A pairs with T. And when we list a genetic sequence, we don't usually give the complementary bases, because anyone who knows the rudiments can figure out what the complementary strand is. So AA pairs with TT.

622 posted on 07/08/2006 9:00:10 AM CDT by DanDenDar

Oh, brother.

Dan, Dan, Dan...

"AAA" doesn't equal 3 base pairs. "AA" does not equal 2 base pairs.

So you got the biology wrong. Then after listing "AA" you contracted yourself with "A does not pair with A."

Then you got the math wrong: it's not 3*1953, it's 3^1953.

Congrats. You're 0 for 3.

[Virginia-American]

There are n = 3*1953 = about 6000 single-point mutations. There are about n^2 two-point mutations. 6000^2 = 36,000,000 is close enuff to 20,000,000. So it looks like every mutation that differed at one or two locations occurrred.

[Southack]

No, js1138's claim was that every possible point mutation occurred and was observed in the experiment. See post #577.

You are trying to re-state the initial claim as if having a mutation at each point was the same as having every possible point mutation at every point.

Disingenuous.

[b_sharp]

Why didn't you just tell him that in the case of a single nucleotide (not a base pair) *at a time* change, calculating a permutation is not applicable?

A longer sequence makes it easier to see.

From the initial sequence:
agtcctgagtctacgtatcgata

We get the following single nuceotide changes:
agtcctaagtctacgtatcgata
agtccttagtctacgtatcgata
agtcctcagtctacgtatcgata
agtcctgggtctacgtatcgata
agtcctgtgtctacgtatcgata
agtcctgcgtctacgtatcgata
agtcctgaatctacgtatcgata
agtcctgattctacgtatcgata
agtcctgactctacgtatcgata

3*3=9 single nucleotide mutations

From his we would get, in addition to all of the above:
agtcctaggtctacgtatcgata
agtcctatgtctacgtatcgata
agtcctacgtctacgtatcgata
agtcctaaatctacgtatcgata
agtcctaattctacgtatcgata
agtcctaactctacgtatcgata
agtcctagatctacgtatcgata
agtcctatatctacgtatcgata
agtcctacatctacgtatcgata
agtcctaggtctacgtatcgata
agtcctagttctacgtatcgata
agtcctagctctacgtatcgata
.
.
.
.
And so on...
until will get all permutations of those three nucleotides (minus duplicates) many of which are *not* single nucleotide mutations.
3³=27 multiple nucleotide mutations

[DanDenDar]

Troll elsewhere, dude. You're not even amusing.

[Southack]

3³=27 multiple nucleotide mutations

626 posted on 07/08/2006 11:58:35 PM CDT by b_sharp (Why bother with a tagline? Even they eventually wear out!)

 

 

If we have three bases, starting from AAA, we get (AAT, AAG, AAC, ATA, AGA, ACA, TAA, GAA, CAA). That's 3*3 = 9, not 3^3 = 27. And so on. You do know * is a multiplication sign, right?
617 posted on 07/07/2006 9:43:05 PM CDT by DanDenDar

[DanDenDar]

He said multiple nucleotide mutations. I said single point mutations.

Tell the truth, dude. The alternative, well, you know what that makes you?

[Southack]

"He said multiple nucleotide mutations. I said single point mutations."

You don't even know the point under debate...

There have been very recent experiments in heat resistant bacteria in which every possible point mutation in the relevant genes was observed. Therefore there are at least some instances in which the source of variation -- random or not -- is irrelevant. ...

577 posted on 07/06/2006 10:47:48 PM CDT by js1138 ...

[DanDenDar]

A point mutation is one point, dude. Go beam up to another universe where points mean somthing else.

Or just try to be an man in this one, and admit you were wrong.

[Southack]

"every possible point mutation"

[DanDenDar]

I'm sorry, dude.

[Southack]

It's OK. Most evolutionists botch the biology and the math, just like you did. I seldom expect more.

...the others tend to have more clever, more original insults than you, though.

[Jean S]

Troll elsewhere, dude. You're not even amusing.

Dude? What, are you 12?

[DanDenDar]

Dude? What, are you 12?

What are you, 98?

[b_sharp]

A point mutation is a single nucleotide change or indel. That means that the rest of the DNA strand remains unchanged. The calculation you perform results in segments of the strand that range from a single nucleotide to the entire strand changing. If we are to only consider those mutations that can be defined as a 'point' mutation, multiple nucleotide changes are out of range.

This restriction to a single point deviation from the original string is what restricts the math to the number of 'other' possible bases at a given 'point' times the number of possible 'points' that can change.

In the sequence CTAG:

If we desire to create a single point mutation we can change the C, the T, the A or the G. If we change more than one of the four, such as the CT, the TA, CG or even CA, then we have gone beyond the initial condition of only changing a single point.

Your math includes all single point changes, all two point changes, all three point changes and all four point changes less duplications.

In light of the above, the argument appears to revolve around whether or not multiple nucleotide changes are to be included in the calculation or, looked another way, whether the 'initial' string for each iteration can contain mutations from a previous instance.

[Elsie]

"With the size of its eyeballs, it couldn't help but have excellent vision," Stevens says.

How big are Blue Whale eyes?

[Elsie]

If T-Rex was a vegetarian, as Hovind asserts, it was certaintly not a predator.

El Toro is a vegetarian, but the Matador is very wary of him!

[Elsie]

Where are the fossils with the high, wide snout without the cheek groves?

Details....

"we KNOW they got to be there; somewhere..."

-- EvoDude