Free Republic
Browse · Search
General/Chat
Topics · Post Article

Skip to comments.

Pedophiles: born that way?
Discover Magazine ^ | Razib Khan

Posted on 05/31/2014 5:36:36 PM PDT by SeekAndFind

Gawker published a piece on the neurological problems which might result in pedophilia, and naturally a lot of shock and disgust was triggered. The piece is titled Born This Way: Sympathy and Science for Those Who Want to Have Sex with Children. This isn’t something you want to click through to lightly. So fair warning. The neurobiological material did pique my interest:

“There was nothing significant in the frontal lobes or temporal lobes,” says Cantor. “It turned out the differences weren’t in the grey matter. The differences were in the white matter.”

“The white matter” is the shorthand term for groupings of myelinated axons and glial cells that transmit signals throughout the gray matter that composes the cerebrum. Think of the gray matter like the houses on a specific electricity grid and the white matter like the cabling connecting those houses to the grid.

“There doesn’t seem to be a pedophilia center in the brain,” says Cantor. “Instead, there’s either not enough of this cabling, not the correct kind of cabling, or it’s wiring the wrong areas together, so instead of the brain evoking protective or parental instincts when these people see children, it’s instead evoking sexual instincts. There’s almost literally a crossed wiring.”

The good news, according to Cantor, is that it if they can figure out how the wiring gets crossed, they might be able to suggest ways pregnant mothers can help ensure their baby is unlikely to be born a pedophile. “It is quite possible that one or more components of the process are related to prenatal stresses like poor maternal nutrition, toxin exposure, ill health, or poor health care,” he says. “If so, then improving health and health care in general may reduce the numbers of people vulnerable to developing pedophilia, as well as other problems.”


Fair enough as far as that goes. I think it is important to look at controversial and explosive topics objectively. You don’t always need to be objective about the issue at hand, or lack opinions, but you need to step back and analyze in a value-free manner on occasion. For me the confusing thing is that to my knowledge Gawker today takes conventionally Leftish stances on “nature vs. nurture” type issues. Would they post something by Steven Pinker defending the concept of robust behavioral differences between the sexes? So why are they sticking their necks out here?

In any case, I think the problem with the Gawker piece is that it doesn’t really come off as a cold and rational assessment. Rather, there is genuine sympathy for people who are afflicted with the mental disease of pedophilia. The author finishes:

The old adage is that the true mark of a society is how it treats the weakest in its ranks. Blacks, women, Latinos, gays and lesbians, and others are still in no way on wholly equal footing in America. But they’re also not nearly as lowly and cursed as men attracted to children. One imagines that if Jesus ever came to Earth, he’d embrace the poor, the blind, the lepers, and, yes, the pedophiles. As a self-professed “progressive,” when I think of the world I’d like to live in, I like to imagine that one day I’d be OK with a man like Terry moving next door to me and my children. I like to think that I could welcome him in for dinner, break bread with him, and offer him the same blessings he’s offered me time and again. And what hurts to admit, even knowing all I know now, is that I’m not positive I could do that.

I’m not a professed “progressive.” I can see where the author is coming from probably (and so can Jonathan Haidt)…but can my progressive readers get into his mind here? Does being progressive mean you can not take into account probability to any extent? That you need to treat people as singular individuals in even the most extreme cases? For example, in the case of a pedophile who has never acted upon their instincts one presumes that they could find social acquaintances who were childless. Many biological dispositions aren’t deterministic, they’re probabilistic. That means controlling or channeling them in non-destructive ways entails changing the situations and contexts one is placed it. That’s not unjust, that’s just common sense. You aren’t a bad person to think it is prudent that someone with pedophile urges should avoid developing close friendships with people with young children.

Many of my liberal readers and friends have expressed the position that if a hereditarian position was true for a range of issue that that would result in a lot of unpleasant normative and political downstream consequences. I’m generally skeptical of this position. I have plenty of hereditarian ideas, and believe it or not I’m not a hateful Nazi. But the response above to the possibility that pedophilia has a biological basis does make me reconsider. I’m not a neo-Freudian, so I had always assumed that this behavior and tendency had neurobiological roots. That didn’t make me any more sympathetic to individuals who committed unmentionable acts. The world isn’t fair, unfortunately.


TOPICS: Health/Medicine; Science; Society
KEYWORDS: culturewar; genetics; homosexualagenda; pedophileagenda; pedophilia; science; sexpositiveagenda; waronchildren
Navigation: use the links below to view more comments.
first previous 1-2021-4041-6061-62 next last
To: SeekAndFind

Birds grow feathers. Fish grow fins. It’s hardwired into their DNA. Murder and pedophilia aren’t hardwired into our DNA. Pedophilia is a choice.


41 posted on 05/31/2014 8:05:58 PM PDT by LibWhacker
[ Post Reply | Private Reply | To 27 | View Replies]

To: SeekAndFind

born that way... just like blacks

if you oppose their ‘life style’, you’re a racist


42 posted on 05/31/2014 8:25:43 PM PDT by sten (fighting tyranny never goes out of style)
[ Post Reply | Private Reply | To 1 | View Replies]

To: KGeorge

No, they won’t suffer as much but it’s a good start.


43 posted on 05/31/2014 8:36:45 PM PDT by Salamander (It's a cult and they worship blue oysters!)
[ Post Reply | Private Reply | To 36 | View Replies]

To: SeekAndFind

I’m just waiting for the Pedo Pride parades.


44 posted on 05/31/2014 8:41:30 PM PDT by TBP (Obama lies, Granny dies.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Hoodat
The day that someone comes up with a pre-natal test that shows whether a baby will be born gay or not will be the same day that abortion on demand is outlawed in all 50 states.

See: Maine State Rep Brian Duprey (R-Hampden)..."gay gene" bill.

45 posted on 05/31/2014 8:46:43 PM PDT by ROCKLOBSTER (Celebrate "Republicans Freed the Slaves" Month.)
[ Post Reply | Private Reply | To 18 | View Replies]

To: nickcarraway

Some men are born more aggressive. Men in general a born programed to try to have sex with women.

We still criminalize assault. We still criminalize rape.

I personally try to hate the crime not the criminal though not always successfully. Societies have developed making criminal some ways were are born. That will probably continue.


46 posted on 05/31/2014 9:50:22 PM PDT by JLS
[ Post Reply | Private Reply | To 3 | View Replies]

To: LibWhacker

we are all born sinful and every one of us has certain sins that appeal to us more than others and in varying degree. not an excuse, just factual reality.

we have to fight against our sin nature every day. to keep it in check.


47 posted on 05/31/2014 10:56:09 PM PDT by Secret Agent Man (Gone Galt; Not averse to Going Bronson.)
[ Post Reply | Private Reply | To 22 | View Replies]

To: SeekAndFind

Men and women are ‘born that way’ because of how God wires them genetically.

Homosexuals and pedophiles are born men and women but have to act on their unnatural desires. They are not ‘born that way’, and no credible evidence has been found to suggest otherwise. They choose.


48 posted on 05/31/2014 11:04:49 PM PDT by Colonel_Flagg ("Compromise" means you've already decided you lost.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: skeeter
I wonder if rapists are born that way.


49 posted on 05/31/2014 11:10:16 PM PDT by gitmo (If your theology doesn't become your biography, what good is it?)
[ Post Reply | Private Reply | To 6 | View Replies]

To: Salamander
"I am leading the charge for Chainsaw Justice in cases of pedophilia"

I'm not quite so bloodthirsty--so messy!

Just shoot,hang and drown them before sending them to the 'lectric chair.

vaudine

50 posted on 05/31/2014 11:31:41 PM PDT by vaudine
[ Post Reply | Private Reply | To 16 | View Replies]

To: SeekAndFind

I have degrees in geology, pharmacy, more damn chemistry, math, physics and aeronautics than you want to know about. I know about neurochemistry, abuse and a predilection to child molestation and worse. I also know it is an evil that must be destroyed.

I do know if someone does “something wrong” to my beautiful granddaughter they are dead. If I have only a short time they would be dead quickly, if I had a long time they would beg for me to kill them. I would hope I had a long time.

Never make a grandfather protect his granddaughter unless you want to experience your worse nightmare. Grandfathers protect the precious and innocent. Do not incur our wrath and if by chance I fail remember they have two grandfathers, not one.


51 posted on 06/01/2014 12:12:52 AM PDT by cpdiii (Deckhand, Roughneck, Mud Man, Geologist, Pilot, Pharmacist THE CONSTITUTION IS WORTH DYING FOR!)
[ Post Reply | Private Reply | To 1 | View Replies]

To: SeekAndFind
When these results were collected, it was found that lesbians and heterosexual men shared a particular “asymmetry” in their hemisphere size, while heterosexual women and gay men had no difference between the size of the different halves of their brain.

In other words, structurally, at least, the brains of gay men were more like heterosexual women, and gay women more like heterosexual men.
A further experiment found that in one particular area of the brain, the amygdala, there were other significant differences.

In heterosexual men and gay women, there were more nerve “connections” in the right side of the amygdala, compared with the left.
The reverse, with more neural connections in the left amygdala, was the case in homosexual men and heterosexual women.

The Karolinska team said that these differences could not be mainly explained by “learned” effects, but needed another mechanism to set them, either before or after birth.

‘Fight, flight or mate’
Dr Qazi Rahman, a lecturer in cognitive biology at Queen Mary, University of London, said that he believed that these brain differences were laid down early in foetal development.
“As far as I'm concerned there is no argument any more - if you are gay, you are born gay,” he said.
The amygdala, he said, was important because of its role in “orientating”, or directing, the rest of the brain in response to an emotional stimulus - be it during the “fight or flight” response, or the presence of a potential mate.
“In other words, the brain network which determines what sexual orientation actually ‘orients’ towards is similar between gay men and straight women, and between gay women and straight men.

“This makes sense given that gay men have a sexual preference which is like that of women in general, that is, preferring men, and vice versa for lesbian women.”
http://news.bbc.co.uk/2/hi/health/7456588.stm

The most likely hypothesis is that pedophilia is as well laid down early in fetal development of the brain.

52 posted on 06/01/2014 3:13:13 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 1 | View Replies]

To: LukeL

That is a dominance thing, not a sexual thing. It’s used as control. Take away a man’s dignity; dehumanize him through rape and the aggressor gets control over the victim. The more it’s done, the more the control.


53 posted on 06/01/2014 8:11:34 AM PDT by Dutch Boy
[ Post Reply | Private Reply | To 11 | View Replies]

To: Maelstorm

People rave about how great Amsterdam is. I was there for a weekend in 1996 and decided that a lot of it wasn’t for me.


54 posted on 06/01/2014 9:56:56 AM PDT by equaviator (There's nothing like the universe to bring you down to earth.)
[ Post Reply | Private Reply | To 30 | View Replies]

To: Salman

...I can just picture old Jerry Sandusky, grumbling in his cell, ‘would it have killed that f’ing grand jury to hold off a few years...’


55 posted on 06/01/2014 10:21:46 AM PDT by IrishBrigade (')
[ Post Reply | Private Reply | To 40 | View Replies]

To: IrishBrigade

I figure at the rate our nation’s degeneration is going, Sandusky will be honored with a commemorative postage stamp in a few years.


56 posted on 06/01/2014 12:35:59 PM PDT by ReformationFan
[ Post Reply | Private Reply | To 55 | View Replies]

To: Salamander

Heh. I was just using the hack saw earlier. And I thought about this thread. Eww, but it would be highly effective.


57 posted on 06/01/2014 1:10:01 PM PDT by KGeorge (Till we're together again, Gypsy girl. May 28, 1998- June 3, 2013)
[ Post Reply | Private Reply | To 43 | View Replies]

To: Maelstorm

‘The whole idea that one is “born that way” which confers the idea that one has no choice or freewill in how they behave sexually ultimately leads to pedophiles, rapists, and all forms of sexual deviants and bad behavior being encompassed under the umbrella of an immutable trait that can not be helped. I’ve been warning that this is where this stupidity was leading. It is an attack on the basic concept on which all notions of liberty are founded which is self determination and freewill.

‘What we are seeing is an erosion of the foundation of a free society in the name of misguided equality. No longer are individuals assumed to be responsible for their behavior but instead a circus of excuses are presented many which are laughable. Human beings are not little dogs that can not pass fire hydrants without marking territory. That some think that civil society should set such a low bar for sexual behavior is like declaring open season for sexual criminals. They no longer evil or deviant but instead just following their God given nature.

‘The defect at the core of this is that human beings have proven with the advent of civilization that they can learn to control their behavior and modify their response through self reflection and consideration of right and wrong behavior. Human beings are born with the natural urge to defecate but they learn to control where and when they defecate. Human beings are born to desire to eat but they learn not to eat poison or inedible things. Human beings are born with natural tendency to get angry, to be scared but they learn to control reactions to these emotions.

‘The idea that sex is some how different is just ridiculous and is an expression of a desire for license to carry on sexually with disregard to any moral code or limit. Even primitive tribes don’t behave this way and for good reason because civilization becomes impossible without men and women who see self control and responsibility as cornerstones as a component of their lives. Learning to defer reactive desire or forgo it entirely is how one chooses not to murder, not to rape, not to steal, not to cheat, not to do all those things that abridge the rights of others.

‘One may be born with the ability to desire to sniff or eat glue but a person with free will can choose not to do those things. A person is born with the capacity for sexual desire but they can choose when and where and who and under what circumstances they will indulge that desire. Those who promote Pedophilia, Homosexuality, and Transexuality are like someone choosing to eat the glue proudly or crap their pants proudly. They know that sticking forks in electric sockets isn’t wise but they do it anyway and demand everyone clap for them approvingly. The worst part is they have built up this superiority complex as if this is “evolved” behavior as if mutilating ones sexual equipment is “evolved” when the evolved thing would be to change the way they think about their irrational desire to be something they were not born to be. The evolved behavior is to see you are male or female and make the best of it and stop trying to be what you weren’t born to be. As for those who have pedophile desires they should know that it is wrong and just not hurt children. A society that lessens the stigma for such behavior is not being enlightened but instead regressing to a level of the savage and setting the stage for even greater victimization of the innocent.’

Well put, Maelstorm.


58 posted on 06/01/2014 1:54:15 PM PDT by ReformationFan
[ Post Reply | Private Reply | To 30 | View Replies]

To: Maelstorm

Well said, although de facto pedophilia is aready okay in some circles. Plenty of homosexual men get their start in the behavior when they’re say, 12 or 13 years old. But then again, according to the reasoning, getting into that behavior us okay. Because they already were homosexual anyways. Forget the STDs they may have contracted.

What’s even worse. The whole belief has changed to be one in favor of let your kid whore around, or get the abortion, becauss your kid is predestined to uncontrolled sez. In times like these, even the term medieval or Victorian hardly sounds like an insult anymore.


59 posted on 06/01/2014 2:30:12 PM PDT by Morpheus2009
[ Post Reply | Private Reply | To 30 | View Replies]

To: Morpheus2009

“What’s even worse. The whole belief has changed to be one in favor of let your kid whore around, or get the abortion, becauss your kid is predestined to uncontrolled sez. In times like these, even the term medieval or Victorian hardly sounds like an insult anymore.”

That’s exactly it. From the Communist Goals of 1963-

24. Eliminate all laws governing obscenity by calling them “censorship” and a violation of free speech and free press.

25. Break down cultural standards of morality by promoting pornography and obscenity in books, magazines, motion pictures, radio, and TV.

26. Present homosexuality, degeneracy and promiscuity as “normal, natural, healthy.”

27. Infiltrate the churches and replace revealed religion with “social” religion. Discredit the Bible and emphasize the need for intellectual maturity which does not need a “religious crutch.”

28. Eliminate prayer or any phase of religious expression in the schools on the ground that it violates the principle of “separation of church and state.”


60 posted on 06/01/2014 2:40:01 PM PDT by ReformationFan
[ Post Reply | Private Reply | To 59 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-2021-4041-6061-62 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
General/Chat
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson