Free Republic
Browse · Search
General/Chat
Topics · Post Article

Skip to comments.

The Babylonian Map of the World with Irving Finkel [17:59]
YouTube ^ | Premiered August 1, 2024 | Irving Finkel, The British Museum

Posted on 08/03/2024 11:40:19 AM PDT by SunkenCiv

The Babylonian map of the world is the oldest map of the world, in the world. Written and inscribed on clay in Mesopotamia around 2,900-years-ago, it is, like so many cuneiform tablets, incomplete. However, Irving Finkel and a particularly gifted student of his - Edith Horsley - managed to locate a missing piece of the map, slot it back into the cuneiform tablet, and from there set us all on journey through the somewhat mythical landscape of Mesopotamia to find the final resting place of the ark. And yes we mean that ark, as in Noah's ark. Although in the earlier Mesopotamian version of the flood story, the ark is built by Ziusudra.
The Babylonian Map of the World with Irving Finkel
Curator's Corner S9 Ep5
| 17:59 | The British Museum | 618K subscribers | 182,572 views | Premiered August 1, 2024
The Babylonian Map of the World with Irving Finkel | Curator's Corner S9 Ep5 | 17:59 | The British Museum | 618K subscribers | 182,572 views | Premiered August 1, 2024

(Excerpt) Read more at youtube.com ...


TOPICS: History; Science; Travel
KEYWORDS: babylon; babylonia; babylonians; cuneiform; epigraphyandlanguage; godsgravesglyphs; imagomundi; irvingfinkel; map
Navigation: use the links below to view more comments.
first previous 1-20, 21-40, 41-52 next last
To: SunkenCiv

Well done, SunkenCiv!

British scholar Dr. Professor Irving Finkel (72) really achieves something here.

He explains how a study of cunneiform tablets can actually tell you highly interesting things about ancient Babylonian civilization.

And that’s hard to do! I was surprised that I watched 85% of this 18 minute YouTube. The video production, graphics, and content is really that good.


21 posted on 08/03/2024 1:09:49 PM PDT by poconopundit (MAGA isn’t a slogan it’s a matter of Americas survival.)
[ Post Reply | Private Reply | To 2 | View Replies]

To: bert

LOL


22 posted on 08/03/2024 1:10:53 PM PDT by SunkenCiv (Putin should skip ahead to where he kills himself in the bunker.)
[ Post Reply | Private Reply | To 17 | View Replies]

To: poconopundit

He really had some fun with it, and so did we! :^)


23 posted on 08/03/2024 1:12:42 PM PDT by SunkenCiv (Putin should skip ahead to where he kills himself in the bunker.)
[ Post Reply | Private Reply | To 21 | View Replies]

To: SunkenCiv

Well, those doodads certainly help. I don’t know how to do any of that formatting stuff beyond the standard HTML.


24 posted on 08/03/2024 1:18:24 PM PDT by Jim W N (MAGA by restoring the Gospel of the Grace of Christ (Jude 3) and our Free Constitutional Republic!)
[ Post Reply | Private Reply | To 12 | View Replies]

To: SunkenCiv
Though Irving doesn't talk about it (often?), some of the first clay cuneiform tablets were (obviously) used for accounting...particularly IOUs.

I suspect IOUs were treated much more carefully than other tablets because they represented real money.

When I was an undergraduate in finance, one of my professors used to call banking the second oldest profession. That would include accounting I think.;-)

25 posted on 08/03/2024 1:19:28 PM PDT by RoosterRedux (“Thinking is difficult, that’s why people prefer to judge”, wrote Carl Gustav Jung.)
[ Post Reply | Private Reply | To 19 | View Replies]

To: AdmSmith

In some ways, he might be considered a colleague of Ron Wyatt who found Noah’s Ark.

https://www.ronwyatt.com/noahs_ark


26 posted on 08/03/2024 1:21:24 PM PDT by reasonisfaith (What are the personal implications if the Resurrection of Christ is a true event in history?)
[ Post Reply | Private Reply | To 5 | View Replies]

To: SunkenCiv

Abrahams father was not semetic.

He was Sumerian.

He was a refugee from the collapsing Sumerian civilization of around 2000 BC. He worshipped other god’s. So even though Moses is reputed as having written the first five books of the bible at a much later date —say 1400 BC. ...the stories from Genesis of the time before Abraham would not have been second hand from other civilizations. Rather they would have been told father to son as being the oral history of their own people. So the biblical Noah story would be the oldest story—even though the bible is predated by other clay cuniform texts.

Abraham’s father, Terah, is mentioned in several passages in the Bible:

Genesis 11:26-32: This passage introduces Terah and his family, including his son Abram (later Abraham). It states that Terah had three sons: Abram, Nahor, and Haran. The family lived in Ur of the Chaldeans, and Terah later moved his family to Haran, where he eventually died at the age of 205.

Joshua 24:2: Joshua recounts the history of Israel, mentioning that Terah, the father of Abraham and Nahor, lived beyond the Euphrates River and worshiped other gods.

Genesis 12:1: Although not a direct reference to Terah, this verse records God’s call to Abram to leave his country, his people, and his father’s household and go to the land God would show him. This implies Abram’s departure from Terah’s household in Haran.

Nehemiah 9:7: In a prayer, Nehemiah refers to God choosing Abram and bringing him out of Ur of the Chaldeans, which indirectly references Terah’s initial move with his family from Ur to Haran.

I asked perplexity.ai what the oldest clay cuniform text that contains the story of noah. perplexity cites dr. finkel.

Based on the search results provided, the oldest clay cuneiform tablet that recounts a story similar to Noah’s flood is approximately 4,000 years old. Specifically:
The tablet described by Dr. Irving Finkel at the British Museum is said to be a “4000-year-old Mesopotamia clay tablet dealing with the ancient biblical story of Noah’s ark” .
The article from The Jewish Chronicle states that this tablet “was written 1,000 years before the Bible” .
Another source confirms it as a “4,000-year-old tablet from ancient Mesopotamia” that reveals details similar to the Old Testament tale of Noah .
It’s important to note that while this tablet contains a flood story with similarities to the biblical account of Noah, it is not identical. The tablet describes a round ark, unlike the traditional rectangular shape depicted in most biblical interpretations . Additionally, this Mesopotamian version predates the writing of the biblical account, though it does not necessarily discredit the Genesis narrative .
The tablet provides evidence of flood stories in ancient Mesopotamian culture that share some elements with the later biblical account, but it represents a distinct tradition rather than being the biblical Noah story itself.

I asked perplexity.ai a second question: Is there any rough agreement among scholars as to the date that Terah left Ur?

Based on the search results provided, there is no clear scholarly consensus on the exact date when Terah left Ur. However, we can infer some approximate timeframes from the information given:
The events described in Genesis involving Terah and Abraham are generally placed in the early second millennium BC, which would be around 2000-1800 BC .
Some chronological details are provided in the Book of Jubilees, an ancient Jewish religious work. According to this source:
Abraham was born in the year 1876 from the beginning of creation (according to their calendar) .
Abraham burned idols in Ur when he was 60 years old, which would be around 1936 in their timeline .
After this incident, Terah and Abraham moved to Haran .
The search results don’t provide a specific agreed-upon date for Terah’s departure from Ur. However, they do mention that Abraham left Haran for Canaan at the age of 75 (Genesis 12:4) .
There is some debate about the chronology, as different ancient sources provide slightly different timelines. For example, the Samaritan Pentateuch records that Terah lived to 145 years, while the Masoretic Text states he lived to 205 years .
It’s worth noting that some scholars question the historical accuracy of placing Abraham’s family in the southern Mesopotamian city of Ur, suggesting instead that “Ur of the Chaldeans” might refer to a northern Mesopotamian location .
In conclusion, while scholars generally place these events in the early second millennium BC (roughly 2000-1800 BC), there isn’t a widely agreed-upon specific date for Terah’s departure from Ur. The lack of consensus is due to variations in ancient sources and ongoing debates about the historical and geographical context of these biblical narratives.

Finally, I asked perplexity AI if scholars think that the Sumerians were a semetic people. This was the answer.

Scholars do not consider the Sumerians to be a Semitic people. The Sumerians are known to have spoken a language isolate, meaning it has no known genealogical connection to any other language, including the Semitic languages. In contrast, the Akkadians, who later conquered the Sumerians, were an East Semitic-speaking people. The Sumerians and Semitic peoples, such as the Akkadians, coexisted and influenced each other culturally and linguistically, but they are distinct groups.


27 posted on 08/03/2024 2:01:53 PM PDT by ckilmer
[ Post Reply | Private Reply | To 1 | View Replies]

To: DannyTN

Finkel is not only an expert in his field, his lectures or public talks are real joys.

You can find a few of them on youtube, as:

https://www.youtube.com/watch?v=s_fkpZSnz2I

https://www.youtube.com/watch?v=zNNaZ110ee4

(so sorry about the Ineligible Harris begging for money adverts, just mute them)


28 posted on 08/03/2024 2:10:54 PM PDT by faithhopecharity ("Politicians aren't born, they're excreted." Marcus Tullius Cicero (106 to 43 BCE))
[ Post Reply | Private Reply | To 3 | View Replies]

To: ckilmer

If you have the time required:

This textbook provides an introduction to the grammar of Sumerian, one of the oldest documented languages in the world. https://www.eltereader.hu/kiadvanyok/english-gabor-zolyomi-an-introduction-to-the-grammar-of-sumerian/


29 posted on 08/03/2024 2:23:05 PM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 27 | View Replies]

To: RoosterRedux; SunkenCiv; AdmSmith; null and void; poconopundit

For those who like facts in addition to jokes, Here are thoughts regarding the term “bitter river” that surrounded their known world. That was almost certainly their term for salt water. Here is a link with a map of the world and numbering a number of world wide cities. Then specific cities are listed, described and modern photos included: https://www.wondermondo.com/ancient-cities-and-towns/

First there was the Persian Gulf leading east to the Indian Ocean as part of the Pacific. Travel across to the the cities of the Indus Valey civilization which was well developed in the time of cunieform writing was likely. To the north were the Black Sea, Sea of Azov, which by connection to the Mediterranean to the west were also salt seas. To the south was the red sea and the larger ocean in ran into. So, definitely surrounded by salt seas everywhere—also mountains.

Appreciate the revised form of the transcript which I will copy and add to my ancient history files.


30 posted on 08/03/2024 2:25:18 PM PDT by gleeaikin ( Question authority as you provide links;)
[ Post Reply | Private Reply | To 16 | View Replies]

To: ckilmer

I thought that Abraham and family were semitic because they were descended from Noah’s som Shem.


31 posted on 08/03/2024 2:26:04 PM PDT by cactusflower
[ Post Reply | Private Reply | To 27 | View Replies]

To: RoosterRedux

:^)


32 posted on 08/03/2024 4:24:35 PM PDT by SunkenCiv (Putin should skip ahead to where he kills himself in the bunker.)
[ Post Reply | Private Reply | To 25 | View Replies]

To: ckilmer

Since Akkadian had become the dominant language in Mesopotamia, including in cities like Ur, sometime around the second millennium BC, isn’t it quite possible that Abram and his father spoke Akkadian and thereby would be considered Semitic since Akkadian is a Semitic language


33 posted on 08/03/2024 5:20:38 PM PDT by RoosterRedux (“Thinking is difficult, that’s why people prefer to judge”, wrote Carl Gustav Jung.)
[ Post Reply | Private Reply | To 27 | View Replies]

To: RoosterRedux

The Akkadians in the northern cities of Sumer were a different people than the Sumerians of the southern cities. They were a semetic people. The Sumerians were not a semetic people. Ur of the Chaldes was a Sumerian city. That’s where Abrahams father was from. That’s what it says in the bible. And he left Ur at the time of Ur’s fall.

No one knows what language Abram’s father spoke.


34 posted on 08/03/2024 5:46:53 PM PDT by ckilmer
[ Post Reply | Private Reply | To 33 | View Replies]

To: gleeaikin
Thanks glee'.

35 posted on 08/03/2024 9:14:23 PM PDT by SunkenCiv (Putin should skip ahead to where he kills himself in the bunker.)
[ Post Reply | Private Reply | To 30 | View Replies]

To: ckilmer; SunkenCiv

Some time ago SC posted some information about discovery of a 1 mile wide meteor crater in the Iraq marshes that seemed to have the age 2,000 BC. How might such an event have affected the Middle East 4 thousand years ago. Might a lot of people in a place like UR have suffered from flooding caused by a meteor smashing into the lower Euphrates? Might someone who had moved away and missed the problems have been noticed for their good luck in moving?

There seemed to have been a number of risings and fallings of various kingdoms and tribal groups around that time. Any more recent writings about this apparent meteor strike and its effects?


36 posted on 08/04/2024 1:23:55 AM PDT by gleeaikin ( Question authority as you provide links;)
[ Post Reply | Private Reply | To 27 | View Replies]

To: ckilmer

For what it’s worth:

The term “Semitic” refers to a family of languages that includes Akkadian, Hebrew, Aramaic, and Arabic, among others. Abram and his family are associated with the Hebrew language, which is part of the Semitic language family.

Biblical Lineage:

According to the Bible, Abram is a descendant of Shem, one of Noah’s sons. The term “Semitic” itself is derived from Shem. This lineage places Abram within the broader category of Semitic peoples.

Cultural and Ethnic Identity:

The Bible situates Abram and his family within the broader cultural and ethnic context of the Semitic peoples. They are depicted as part of the migratory Semitic groups that moved through Mesopotamia and the Near East.


37 posted on 08/04/2024 2:22:51 AM PDT by RoosterRedux (“Thinking is difficult, that’s why people prefer to judge”, wrote Carl Gustav Jung.)
[ Post Reply | Private Reply | To 34 | View Replies]

To: ckilmer

More of the same (FWIW):

Abram, who is later named Abraham, is a direct descendant of Shem. According to the genealogies in the Bible, Abram is the tenth generation from Noah through Shem. The genealogy is outlined in the Book of Genesis, specifically in chapters 10 and 11. Here is the lineage from Shem to Abram:

Shem:

Arphaxad (Shem’s son)
Shelah (Arphaxad’s son)
Eber (Shelah’s son)
Peleg (Eber’s son)
Reu (Peleg’s son)
Serug (Reu’s son)
Nahor (Serug’s son)
Terah (Nahor’s son)
Abram (Terah’s son)

Thus, Abram is the great-great-great-great-great-great-great-grandson of Shem. This lineage places Abram within the Semitic line, linking him to the broader heritage of the Semitic peoples.


38 posted on 08/04/2024 2:30:09 AM PDT by RoosterRedux (“Thinking is difficult, that’s why people prefer to judge”, wrote Carl Gustav Jung.)
[ Post Reply | Private Reply | To 34 | View Replies]

To: gleeaikin
The curseofagade keyword, sorted:

39 posted on 08/04/2024 7:12:06 AM PDT by SunkenCiv (Putin should skip ahead to where he kills himself in the bunker.)
[ Post Reply | Private Reply | To 36 | View Replies]

To: ckilmer

Uh, no.


40 posted on 08/04/2024 7:12:46 AM PDT by SunkenCiv (Putin should skip ahead to where he kills himself in the bunker.)
[ Post Reply | Private Reply | To 27 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20, 21-40, 41-52 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
General/Chat
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson