Skip to comments.
Golden Necklaces Discovered in Bronze Age Tomb [Poland]
Heritage Daily ^
| February 28, 2023
| Markus Milligan
Posted on 03/09/2023 11:02:16 AM PST by SunkenCiv
The Metsamor archaeological site is located near the village of Taronik, in the Armavir Province of Armenia, where the oldest trace of human settlement dates from the 4th millennium BC during the Copper Age.
In the Bronze Age and Early Iron Ages, the site became an important religious and economic centre, developing into a city with many temples and sanctuaries, fortified by a citadel and cyclopean walls, and an advanced economy based on metallurgical production.
Recent excavations have uncovered a sunken chamber framed by large stones, containing the remains of a wooden burial and two skeletons who died at the age of 30 to 40-years-old during the Late Bronze Age around 1300–1200 BC.
Archaeologists also found over a hundred beads made from gold and carnelian which formed three necklaces, as well as golden pendants, a dozen complete ceramic vessels, and a unique faience flask imported from the Syrian-Mesopotamian borderland.
The tomb was found in a necropolis where over 100 graves have already been examined, with only several having been looted during antiquity.
Metsamor is a protected archaeological site with the status of an archaeological reserve. Excavations in the area have been carried out since 1965, uncovering other examples of gold necklaces and gilded belt fittings with depictions of hunting lionesses.
(Excerpt) Read more at heritagedaily.com ...
TOPICS: History; Science; Travel
KEYWORDS: armavirprovince; armenia; bronzeage; carnelian; copper; copperage; faience; godsgravesglyphs; gold; markusmilligan; mesopotamia; metallurgy; metsamor; necropolis; poland; sword; swords; taronik
Navigation: use the links below to view more comments.
first 1-20, 21 next last
subtitle: A Team of Polish and Armenian Archaeologists Have Discovered a Tomb at the Metsamor Archaeological Site, Containing Ornate Golden Necklaces That Date From the Bronze Age.
1
posted on
03/09/2023 11:02:16 AM PST
by
SunkenCiv
The other 333 topics of the Bronze Age keyword, processed, sorted, grouped by year posted.
- Discovery of Bronze Age child's shoe suggests perennial problem of toddlers dropping their things stretches back 3,000 years [02/24/2023]
- Ancient road found beneath new town in Devon [02/21/2023]
- 3,600-year-old hoards may contain the earliest silver currency in Israel and Gaza [01/30/2023]
- Sword Mistaken For Replica Is Actually An Ancient 3,000-Year-Old Weapon [01/25/2023]
- The inner parts of the Oslofjord contains some of the most exciting traces of Stone Age people in Europe [01/23/2023]
- Archaeologists Unearth 3,000-Year-Old Wishing Well in Germany [01/22/2023]
- Discovery of the temple of Poseidon located at the Kleidi site near Samikon in Greece [01/15/2023]
- Hundreds of 4,500-yr-old tombs found in central China [01/04/2023]
- Archaeologists discover Bronze Age monument in Turku [Finland] [12/16/2022]
- 4,000-year-old 'shaman' burial near Stonehenge has a golden secret [12/16/2022]
- Gold From Ancient Troy, Poliochni And Ur Had The Same Origin [12/02/2022]
- New Study Of Uluburun Shipwreck Reveals Ancient Trade Network [12/02/2022]
- Bronze Age gold belt with 'cosmological' designs unearthed in Czech beet field [10/30/2022]
- Drone photos reveal an early Mesopotamian city made of marsh islands [10/23/2022]
- Research finds mysterious structure in Cork Harbour is prehistoric tomb [10/21/2022]
- 'Extremely rare' Rameses II-era burial cave found in Israel [09/20/2022]
- A Bronze Age food vessel unearthed during a high street demolition 42 years ago has gone on display at a nearby museum [09/19/2022]
- Astronomy Picture of the Day - Analemma over the Callanish Stones [09/18/2022]
- Gibraltar Recognised as a British city, 180 years ate [08/29/2022]
- Extraordinary Trove of Ancient Gold Rings Discovered in Romanian Grave [08/29/2022]
- Study Challenges Views On What Drove Major Changes In Ancient Greek Society On Crete [08/28/2022]
- DNA analysis shows Griffin Warrior ruled his Greek homeland: The Bronze Age leader was from the region he would come to rule [08/28/2022]
- Ancient tooth DNA reveals how 'cold sore' herpes virus has evolved [08/24/2022]
- Glacial Archaeologists Find Arrow In Melting Ice [08/21/2022]
- 10 World's Oldest Things From Armenia [08/16/2022]
- Pathogens Detected in Bronze Age Remains in Greece [08/14/2022]
- Prehistoric roots of 'cold sore' virus traced through ancient herpes DNA [08/01/2022]
- Secrets of the Stone Age [YT vid in two parts] [07/28/2022]
- Romans may have destroyed Moray metal-working site [07/22/2022]
- Latest find in Turkey's Ayasuluk Hill links Hittites to Ephesus [07/09/2022]
- Discovery of Anglo Saxon burials of national significance [06/19/2022]
- Czech scientists reveal striking look of a Bronze Age woman from Bohemia [06/13/2022]
- Ancient tombs point to rich families from wealthy Cypriot community [06/11/2022]
- A 3400-year-old city emerges from the Tigris River [06/04/2022]
- Gloucestershire archaeologists make "phenomenal" find on dig's first day: Buried for some 3,000 years, a Bronze Age spearhead makes a point [06/02/2022]
- Czech scientists reveal striking look of a Bronze Age woman from Bohemia [06/02/2022]
- Archaeologists discover 3,000-year-old Mont'e Prama stone giants [Sardinia] [05/16/2022]
- We Thought We Knew What These Ancient Daggers Were Used For, But We Were Wrong [05/10/2022]
- Research finally answers what Bronze Age daggers were used for [05/02/2022]
- Imported Lead Ingots Offer Evidence of Complex Bronze Age Trade Networks: A new analysis of shipwrecked metals inscribed with Cypro-Minoan markings suggests the objects originated in Sardinia, some 1,550 miles away from Cyprus [04/05/2022]
- Stunning 3D image recreates real Stone Age woman [03/18/2022]
- Ancient Greek Corinthian Helmet Found in Southwest Russia [02/25/2022]
- Ancient mass migration transformed Britons' DNA [12/23/2021]
- Central European prehistory was highly dynamic [12/12/2021]
- Two Bronze Age hoards found on farm near Royston [12/12/2021]
- New tests show neolithic pits near Stonehenge were human-made [12/12/2021]
- The cosmic mystery of Seahenge: For 4,000 years it lay hidden beneath the Norfolk sands. Now, as it goes on show, a battle is raging over the true purpose of the awesome monument [12/12/2021]
- Gold [jewelry] from the time of Nefertiti found in Bronze Age tombs [12/05/2021]
- 3,250-year-old seal belonging to Hittite prince discovered in southern Turkey [11/23/2021]
- Genetic changes in Bronze Age southern Iberia [11/22/2021]
- Farmers in NE China initial speakers of Japanese, Korean, Turkish languages: Study [11/16/2021]
- Bronze Age Tarim mummies aren't who scientists thought they were [10/28/2021]
- "Discovery of a lifetime" golden sun bowl discovered in prehistoric settlement [Ebreichsdorf, Austria] [10/12/2021]
- Dog DNA reveals ancient trade network connecting the Arctic to the outside world [10/12/2021]
- 4000-year-old sword found in Finland [3700 years] [10/12/2021]
- Exploring the life story of a high-status woman from isotope data in Hungary's largest Bronze Age cemetery bronze age cemeteries [10/12/2021]
- Scientists solve the mystery of the Etruscans' origins [09/28/2021]
- Wilderness Wanderings: Where is Kadesh? [06/02/2021]
- Bronze Age village found under Swiss lake [05/03/2021]
- Ancient 'untouched' tomb discovered on Dingle Peninsula [Bronze Age, County Kerry, Ireland] [04/20/2021]
- David Rohl : Greek Dark Age, Hyksos Invasion and Sea Peoples [04/14/2021]
- Bronze Age slab found in France is oldest 3D map in Europe [04/10/2021]
- Dazzling Treasures Unearthed in Bronze Age Grave Likely Belonged to a Queen [04/05/2021]
- Rabbits dig up 9,000-year-old artifacts on 'Dream Island' ... These bunnies have dug where no archaeologist has dug before. [04/01/2021]
- Historical Discovery Revives Wild Theories About Aliens in Ancient China [03/24/2021]
- Discovery of Biblical Scrolls Shows Importance of Greek Old Testament, Scholar Says [03/21/2021]
- Israeli archaeologists discover biblical scroll fragments for the first time in 60 years [03/18/2021]
- Dead Sea scroll discovery brings tantalizing prospect of more yet to be found [03/17/2021]
- In a Remarkable Find, Archaeologists Exploring the 'Cave of Horror' in Israel Have Discovered a New Dead Sea Scroll [03/16/2021]
- DNA reveals ancient Croatian massacre was an indiscriminate killing [03/16/2021]
- Bible scroll from Bar Kochba era discovered in Judean Desert [03/16/2021]
- Israeli archeologists discover new Dead Sea Scrolls for first time in 60 years [03/16/2021]
- Bronze Age spear found by a metal detectorist on a Jersey beach [02/28/2021]
- Hidden secrets revealed in microscopic images of ancient artifacts [01/16/2021]
- Melting glacier sheds light upon hidden Viking era artifacts in Norway dated back to 300 AD [12/17/2020]
- 'Europe's oldest battle' in Germany's Tollense Valley 3,250 years ago may actually have been a brutal MASSACRE of 1,400 Bronze Age merchants [10/26/2020]
- Lactose tolerance spread throughout Europe in only a few thousand years [09/16/2020]
- Radiocarbon dating and CT scans reveal Bronze Age tradition of keeping human remains [09/06/2020]
- Cryptic Nebra sky disk might not be so ancient after all, say scientists [09/05/2020]
- Archaeologists uncover 5,700-year-old Neolithic house in north Cork [09/01/2020]
- Rapid acceptance of foreign food tradition in Bronze Age Europe [08/25/2020]
- Mysterious discover[y] - Bronze Age tomb hidden underneath millstones [08/11/2020]
- Massive ancient temple complex may lurk beneath famous Northern Ireland fort [08/11/2020]
- "Woodhenge" discovered in prehistoric complex of Perdigies [08/06/2020]
- The most ancient evidence of horsemanship in the bronze age [07/15/2020]
- Trekking The Roman Road To Scotland [05/31/2020]
- How did the plague reshape Bronze Age Europe? [05/20/2020]
- Global cooling event 4,200 years ago spurred rice's evolution, spread across Asia [05/18/2020]
- 4,200-year-old burial of Bronze Age chieftain discovered under UK skate park [05/05/2020]
- Disc-Like Copper Ingots Found in Ancient Shipwreck at Bulgaria's Black Sea Coast Similar to Gelidonya, Uluburun Shipwrecks of Mediterranean Turkey [04/30/2020]
- The mystery of the 'blue monkeys' in ancient Grecian frescoes, solved [04/27/2020]
- Copper's Virus-Killing Powers Were Known Even to the Ancients [04/16/2020]
- 5,000-year-old egg hunt: Research reveals surprising complexity of ancient ostrich egg trade [04/09/2020]
- Mysterious 5000 year-old sword discovered... [03/26/2020]
- 5,000-year-old sword discovered in Venice [03/01/2020]
- Archaeology -- Social inequality in Bronze Age households [02/04/2020]
- Ancient monkey painting suggests Bronze Age Greeks travelled widely [02/04/2020]
- Archaeologists find Bronze Age tombs lined with gold [12/18/2019]
- Havering Hoard: Weapons found on building site to go on show [10/31/2019]
- Great Orme copper mine 'traded widely in Bronze Age' [Wales] [10/31/2019]
- 4,000-Year-Old Brain Tissue Was Preserved After Boiling In Its Own Fluids [10/29/2019]
- Lost in Combat? [3000 years ago] [10/18/2019]
- Bronze Age 'New York' discovered, Israeli archaeologists say [10/13/2019]
- Once Considered 'Simple,' the Ancient Edomites Were Actually Tech Geniuses [09/24/2019]
- Groundbreaking study: Ancient tin ingots found in Israel were mined in England [09/23/2019]
- ISRAELI RESEARCHERS IDENTIFY BIBLICAL KINGDOM OF EDOM [09/22/2019]
- New Birthplace of Chinese Civilization [08/23/2019]
- Nordic Bronze Age attracted wide variety of migrants to Denmark [08/22/2019]
- Ancient feces reveal how 'marsh diet' left Bronze Age Fen folk infected with parasites [08/22/2019]
- Greek Farmer Accidentally Discovers 3,400-Year-Old Minoan Tomb Hidden Under Olive Grove [08/10/2019]
- Plague in humans 'twice as old' but didn't begin as flea-borne, ancient DNA reveals [07/28/2019]
- The road to Scandinavia's bronze age: Trade routes, metal provenance, and mixing [07/25/2019]
- 4,000-Year-Old Burial Revealed on Britain's 'Island of Druids' [06/29/2019]
- Archaeologists uncover megalithic monument thought to be unlike any found in Ireland to date [06/16/2019]
- The short life of Must Farm [Late Bronze Age settlement in Cambridgeshire] [06/14/2019]
- 3,600-yr-old Shipwreck Uncovered Could be Oldest Ever Found in the Mediterranean [Antalya, Turkey] [05/17/2019]
- A history of the Crusades, as told by crusaders' DNA [04/22/2019]
- Teenage Priestess from the Bronze Age Was Probably No Globetrotter [04/08/2019]
- Ancient DNA research shines spotlight on Iberia [03/15/2019]
- China's beastly bronze designs found in stone carvings at prehistoric settlement [03/02/2019]
- Soldiers find skeleton of Saxon warrior on Salisbury Plain [03/01/2019]
- The Last Days of Canaanite Azekah [02/27/2019]
- The Caucasus: Complex interplay of genes and cultures [02/11/2019]
- Long Bronze Age sequence and earlier Chalcolithic occupation... at Kisonerga-Skalia [Cyprus] [01/01/2019]
- Evidence of Sodom? Meteor blast cause of biblical destruction, say scientists [11/22/2018]
- Extensive trade in fish between Egypt and Canaan already 3,500 years ago [10/22/2018]
- Mysterious gold cones 'hats of ancient wizards' [10/13/2018]
- Broad genetic variation on the Pontic-Caspian Steppe [Scythians] [10/09/2018]
- Traces of opiates found in ancient Cypriot vessel [10/08/2018]
- Minoan palace of Zominthos in Crete yields exciting Bronze Age finds [09/30/2018]
- Ancient Bronze Hand Found in Switzerland Mystifies Archeologists [09/28/2018]
- Mushroom picker finds precious helmets from late Bronze Age [Slovakia] [09/23/2018]
- Ancient Italian Skeletons Had Hemp In Their Teeth, Archaeologists Discover [09/04/2018]
- Sicilian amber in western Europe pre-dates arrival of Baltic amber by at least 2,000 years [09/02/2018]
- Intact tomb of Bronze Age Minoan man discovered in Ierapetra, Crete [08/25/2018]
- Salt of the Alps: ancient Austrian mine holds Bronze Age secrets [08/24/2018]
- Humans were visiting Staffa in the Bronze Age, scientists find [08/17/2018]
- Dating the Ancient Minoan Eruption of Thera Using Tree Rings [08/16/2018]
- Skeletons of 5,000-year-old found buried alongside remains of two sacrificed horses (trunc) [07/28/2018]
- Researcher's swinging blade offers glimpse into how ancient Mycenaeans built palaces [05/05/2018]
- Ancient Chinese bronze shapes from 1600 to 256 BC, to music of the Taoist Music Orchestra [04/21/2018]
- Ancient Cornish barrow site discovered [04/02/2018]
- First Modern Britons Had 'Dark To Black' Skin, Cheddar Man DNA Analysis Reveals [02/06/2018]
- REVEALED: Scientists find man with 'perfect smile' in 3,500 year-old BRONZE AGE SKELETON [01/29/2018]
- Archaeologists Race Melting Glaciers 2 Rescue Iron & Bronze Age Artifacts Exposed by Climate Change [01/24/2018]
- Melting [Norwegian] mountain ice reveals thousands of stunningly-preserved artefacts [01/23/2018]
- Complex engineering and metal-work discovered beneath ancient Greek 'pyramid' [01/18/2018]
- Sprawling Greek monuments built 4,500 years ago on 'the world's oldest maritime sanctuary'... [01/18/2018]
- 4,500-year-old statue with almond-shaped eyes and bushy eyebrows in a Bronze Age child's grave [12/28/2017]
- How Asian Nomadic Herders Built New Bronze Age Cultures [11/30/2017]
- Prehistoric women's arms 'stronger than those of today's elite rowers' [11/30/2017]
- Prehistoric women's manual labor exceeded that of athletes through the first 5500 years of farming [11/29/2017]
- Bronze Age farmer Tam is earliest known Stirling resident [11/09/2017]
- Gaza Bronze Age Remains Disappearing Under Concrete [11/01/2017]
- What Europe's most ancient battlefield reveals [10/09/2017]
- DNA clue to origins of early Greek civilization [08/03/2017]
- Finds in Jerusalem shore up biblical account of Babylonian conquest [07/27/2017]
- Significant Bronze Age city discovered in Northern Iraq [11/07/2016]
- For Peaceable Humans, Don't Look to Prehistory [07/01/2016]
- Ancient Canaanites Imported Animals from Egypt [06/25/2016]
- 'Pristine' Landscapes Haven't Existed For Thousands Of Years Due To Human Activity [06/18/2016]
- Indus Valley civilisation may pre-date Egypt's pharoahs: Ancient society is 2,500 years older [tr] [06/02/2016]
- Devastating 'World War ZERO' destroyed ancient civilisations and plunged Europe into a dark age [05/15/2016]
- World War Zero brought down mystery civilisation of 'sea people' [05/13/2016]
- 3600-year-old Swedish Axes Were Made With Copper From Cyprus [05/12/2016]
- Half Of Western European Men Descended From One Bronze Age 'King' [04/30/2016]
- Excavations at Idalion, Cyprus: Crossing Cultures in the Eastern Mediterranean [April 6, 2016] [04/01/2016]
- Unexpected and Gruesome Battle of 1250 BC Involved 4,000 Men from Across Northern Europe [03/25/2016]
- Archaeologists find Bronze Age shipwreck off Turkey̢¢s southwest [02/03/2016]
- 'A bronze age Pompeii': archaeologists hail discovery of Peterborough site [01/13/2016]
- 3,400-year-old Canaanite Fort to Be Incorporated Into High-rise [01/08/2016]
- Archaeological discovery yields surprising revelations about Europe's oldest city [01/08/2016]
- First ancient Irish human genomes sequenced [01/01/2016]
- Newberry Tablet [12/26/2015]
- Shifting Sand Dunes Reveal Large Bronze Age Settlement [Orkney] [12/12/2015]
- The first inter-cultural â¬Ëœparty⬢ in Europe? [12/07/2015]
- Tel Gezer Water System Built by Canaanites? [11/23/2015]
- Archaeologists discover possible ruins of ancient Sodom in the Holy Land [10/03/2015]
- Mummification was commonplace in Bronze Age Britain [10/02/2015]
- Fit for a God? Ancient Booty Discovered in Transylvania [09/30/2015]
- Builders in Omsk stumble across Bronze Age burial site [09/30/2015]
- Possible site of ancient Sodom yields more finds [09/29/2015]
- Bronze Age Greek city found underwater [08/31/2015]
- Gold Sun Disc from time of Stonehenge revealed to the public [06/23/2015]
- Arsonists torch storerooms with 4,000-year-old artifacts [koranimals] [06/17/2015]
- Most European men descend from a handful of Bronze Age forefathers [05/27/2015]
- Bulgarian Archaeologists Stumble Upon 'Oldest Children's Toy in Europe': Late Bronze Age Thracian... [05/09/2015]
- The Minoans of Crete [05/07/2015]
- 1177 BCE, the year a perfect storm destroyed civilization [05/03/2015]
- DNA study shows that Celts are not a unique genetic group [03/19/2015]
- Bronze Age palace discovered in southern Spain [03/14/2015]
- Alexander the Great-Era Treasure Found in Israeli Cave [03/10/2015]
- Archaeologists discover secret room in ancient Sidon temple [Phoenicians] [02/28/2015]
- European languages linked to migration from the east [02/13/2015]
- Late Bronze Age treasure found in the field near Chojnice [01/04/2015]
- Exotic weapons buried in field could have arrived in Wales by long-distance sea travel [Europe] [12/26/2014]
- Danish Bronze Age glass beads traced to Egypt [12/09/2014]
- Climate Change Not a Cause of Bronze Age Collapse [11/25/2014]
- "Amazing" Bronze Age burial in Buckinghamshire contained skeletons of two children... [11/09/2014]
- Greek Bronze Age ended 100 years earlier than thought, new evidence suggests [10/17/2014]
- Millennia-old sunken ship could be world's oldest, researchers suggest [09/21/2014]
- Boy discovers 3000-year-old bronze sword in China [09/06/2014]
- The Greek Age of Bronze -- Middle Helmets [04/24/2014]
- 4,500-year-old boat among Viking artifacts hoard discovered in Galway [04/12/2014]
- Ancient nomads spread earliest domestic grains along Silk Road, study finds [04/05/2014]
- DNA shows Irish people have more complex origins than previously thought [01/11/2014]
- 3,000-year-old shipwreck shows European trade was thriving in Bronze Age [11/26/2013]
- Ancient City Discovered Beneath Biblical-Era Ruins in Israel [11/18/2013]
- Pollen Study Points to Drought as Culprit in Bronze Age Mystery (Global Warming in Ancient Times) [10/26/2013]
- Alpine Archaeology Reveals High Life Through the Ages [09/28/2013]
- Evidence of Production of Luxury Textiles and Extraction of Copper from ... Cypriote Bronze Age City [09/07/2013]
- Minoan Frescoes at Tel Kabri: Aegean Art in Bronze Age Israel [07/21/2013]
- Bronze Age boat reconstruction is altering archaeologists' view of era [06/01/2013]
- Prehistoric and Roman Remains Rewrite History of the Tees Estuary [05/15/2013]
- Snowy landscape reveals Wales' forgotten ancient remains [03/29/2013]
- Study revisits mystery of Egyptian King Ramesses III's killing [12/18/2012]
- Ancient 'sauna' unearthed in Assynt [10/20/2012]
- Archeology: Prehistoric rock art found in caves on Terceira Island -- Azores [10/06/2012]
- The Sea Peoples, from Cuneiform Tablets to Carbon Dating [10/04/2012]
- Brewing Stone Age beer [08/05/2012]
- Massive Gold Trove Sparks Archeological Dispute [06/21/2012]
- Welsh people could be most ancient in UK, DNA suggests [06/20/2012]
- The Birth of Bureaucracy (Where Long Lines, Red Tape & Arcane Rules Began; 1650 to 1100 B.C.) [06/13/2012]
- Bronze Age 'Facebook' discovered by Cambridge experts [05/19/2012]
- Modern Man Tries to Build a 3,500 Year Old Boat from the Bronze Age and Fails [05/15/2012]
- Neolithic farmers brought deer to Ireland [05/14/2012]
- Ancient Germany's Metal Traders [05/06/2012]
- Must Farm Bronze Age site: Archaeologists at work [ East Anglia, 3K yr old boat ] [01/16/2012]
- Archaeologists dig at Pillar of Eliseg near Llangollen [09/07/2011]
- Michigan Copper in the Mediterranean [08/06/2011]
- 'Extraordinary' genetic make-up of north-east Wales men [07/23/2011]
- Archaeologists Puzzle Over Opulent Prehistoric Burial Find [07/01/2011]
- Sea Peoples invade: 1192 -- 1190 BC [06/16/2011]
- "Early Bronze Age battle site found on German river bank" [05/22/2011]
- Early Bronze Age battle site found on German river bank [05/22/2011]
- Unearthed Aryan cities rewrite history [10/04/2010]
- The Impact of Abrupt Climate Change around 2650 BP in NW-Europe, Evidence for Climatic Teleconnec... [09/23/2010]
- Bronze Age henge found in Hertfordshire [08/25/2010]
- Ancient Chronography, Eratosthenes and the Dating of the Fall of Troy [abstract] [07/14/2010]
- Archaeological mystery solved (Sea-Peoples and the Song of Deborah) [07/01/2010]
- The Egtved Girl [02/16/2010]
- A Lost European Culture, Pulled From Obscurity [11/30/2009]
- "The Catastrophe" What the End of Bronze-Age Civilization Means for Modern Times [09/28/2009]
- Grave discovered at royal centre[Scotland] [08/16/2009]
- Phaistos Disk: Greek or Luwian? [06/25/2009]
- Making merry at Knossos [05/15/2009]
- Ancient Greece's 'global warming' [05/08/2009]
- 3,000 year-old bracelet found in Tyrone field[Northern Ireland] [04/20/2009]
- Clues to ancient invasion in DNA [ Scotland, Ireland, Picts, Vikings ] [04/06/2009]
- White Masters in the deserts of China? [03/11/2009]
- Myanmar finds more evidences on Bronze Age, Iron Age [03/09/2009]
- Liverpool treasure hunters unearth Bronze Age jewellery in Wrexham field[UK] [12/11/2008]
- Rare Bronze Age necklace is found [ Britain ] [12/01/2008]
- Archaeology professor scrutinizes age-old mystery [ Uluburun wreck excavation] [11/24/2008]
- Grog of the Greeks [ barley beer, honey mead, retsina wine ] [10/20/2008]
- Archaeologists find bones from prehistoric war in Germany [10/11/2008]
- Bronze Age mouse offers clues to royal shipwreck [ Ulu Burun wreck ] [09/09/2008]
- Normand Hammond [09/04/2008]
- Uncovering the ultimate family tree [08/26/2008]
- Alpine melt reveals ancient life [ Schnidejoch glacier ] [08/26/2008]
- Exploring the blue depths of the Aegean and Mediterranean [08/04/2008]
- Exploration of underwater forest [Loch Tay] [07/16/2008]
- Cavemen and their relatives in the same village after 3,000 years [07/16/2008]
- Archaeologists find grave of suspected vampire [07/14/2008]
- Unique Dutch Settlement Discovered From Bronze Age [05/24/2008]
- New research forces U-turn in population migration theory [05/23/2008]
- Bronze Age Burial 'With Beer Mug' [03/17/2008]
- Mystery 'Mound' To Be Saved From The Sea (Shetlands) [01/26/2008]
- Rogem Hiri An Ancient, Mysterious Construction [01/19/2008]
- In a rich corner of antiquity: gold, wine, plenty of luxury [Colchis, the Vani] [12/29/2007]
- Excavations In The East Jordan Land [12/14/2007]
- 2 ancient graveyards found near Damascus [Bronze Age] [12/10/2007]
- Digging Biblical History, Or The End Of The World [11/21/2007]
- Eco-Ruin 'Felled Early Society' [11/15/2007]
- Archaeologists Find Mystery Carved Stone At Whitby Abbey (UK) [10/12/2007]
- Greece Is The Word For Volcanoes (Thera) [08/25/2007]
- How Bronze Age man Enjoyed His Pint [08/12/2007]
- Perthshire Rock Art Sheds Light On Scotland's Prehistoric Past [08/05/2007]
- Workers Discover Ancient 'Snake' (UK) [07/05/2007]
- The wave that destroyed Atlantis [Destroyed by a giant tsunami?] [04/22/2007]
- Climate Key To Sphinx's Riddle [01/08/2007]
- Ancient DNA (Cheddar Man, Otzi, Etc) [01/07/2007]
- Shattered clues for solving Greek island's riddle [12/28/2006]
- 4,000-Year-Old Seahenge To Rise Again - But Not Until 2008 [12/13/2006]
- The Sea Peoples [11/11/2006]
- Gristhorpe Man 'Was Bronze Age Chieftain' [09/06/2006]
- Uncovering the burial mounds of Bronze Age Scots [08/27/2006]
- Bronze age canoe stops pipeline(UK) [08/24/2006]
- Crete: isle of the dead? [08/03/2006]
- Replica of 3,300-year-old shipwreck arrives in Bodrum [ Uluburun II ] [07/02/2006]
- Think Pompeii Got Hit Hard? Worse Eruptions Lurk [03/07/2006]
- Unprecedented mathematical knowledge found in (Minoan) Bronze Age wall paintings. [03/02/2006]
- Anatolian tree-ring studies are untrustworthy [02/03/2006]
- Greek Shipwreck from 350 BC Revealed [02/02/2006]
- Ancient Furnace Sparks Archaeological Interest [01/22/2006]
- Experts Prepare Excavation on Greek Island [01/09/2006]
- 'Ancient' boat expedition hits trouble [09/09/2005]
- The Amesbury Archer: King of Stonehenge? [08/31/2005]
- King of the Wild Frontier (Hyksos art and architecture in the Sinai) [08/15/2005]
- Helike, ancient Greek city swallowed by the sea [07/02/2005]
- Unearthing of Skeletons Sheds Light on Legend of Saint (Scotland) [05/06/2005]
- Pompei Discovery For Swedish Archaeologists [04/17/2005]
- Ancient Cypriot Copper Mine For Sale (Herod's Mine) [04/13/2005]
- Gold Love Ring is Treasure Trove (Bronze Age Artefacts Found in Wales) [04/02/2005]
- Townhouse reveals real skeletons in closet [03/17/2005]
- Chariot find is a victory for Scots [03/10/2005]
- Russian Culture Official Suggests Legendary Gold Collection From Troy Unlikely be Returned Germany [02/27/2005]
- Pompeii's Burial Not Its First Disaster [12/02/2004]
- Arzawa [11/26/2004]
- Irish, Scots And Welsh Not Celtic - Scientist [09/09/2004]
- Sailing the Wine-Dark Sea: International Trade and the Late Bronze Age Aegean [08/28/2004]
- Ancestors Of Turks Came To Anatolia In 2000s BC [08/27/2004]
- Move Over, Pompeii [08/10/2004]
- Human Sacrifice Was Rarer Than Thought [07/22/2004]
- Caves Hold Clue To The Riddle Of The Three Hares [07/03/2004]
- Italian Skeletons Reveal Old World Diseases [04/13/2004]
- Tests Reveal Amesbury Archer "King Of Stonehenge' Was A Settler From The Alps [02/08/2004]
- Scientists Unearth Urban Center More Ancient Than Plato [12/01/2003]
- Meet The Ancestors [08/20/2003]
- Celtic Found to Have Ancient Roots [07/01/2003]
- Y Chromosomes Rewrite British History [06/24/2003]
- Dozens of women want Bronze Age hunter's babies [04/25/2003]
- Stonehenge "King" was from central Europe [02/10/2003]
- Unearthed: The Humble Origins Of World Diplomacy (Hittites) [01/18/2003]
- Celestial Bronze Age disc recovered [10/04/2002]
- Bronze Age observatory to be rebuilt in Germany [09/15/2002]
- Unearthed, The Prince Of Stonehenge [08/25/2002]
- Comets,Meteors & Myth: New Evidence For Toppled Civilizations And Bibical Tales [08/11/2002]
- Who Really Discovered America? [07/14/2002]
- Did Asteroids And Comets Turn The Tides Of Civilization? [07/11/2002]
- Archaeologists Rewrite Timeline Of Bronze And Iron Ages, Alphabet [12/24/2001]
- 'Bronze Age Pompeii' Found In Italy [12/06/2001]
- Genetic Survey Reveals Hidden Celts Of England [12/06/2001]
2
posted on
03/09/2023 11:03:13 AM PST
by
SunkenCiv
(Imagine an imaginary menagerie manager imagining managing an imaginary menagerie.)
To: StayAt HomeMother; Ernest_at_the_Beach; 1ofmanyfree; 21twelve; 24Karet; 2ndDivisionVet; 31R1O; ...
3
posted on
03/09/2023 11:05:34 AM PST
by
SunkenCiv
(Imagine an imaginary menagerie manager imagining managing an imaginary menagerie.)
To: SunkenCiv; All
Very nice!
4
posted on
03/09/2023 11:09:36 AM PST
by
BenLurkin
(The above is not a statement of fact. It is either opinion, or satire, or both.)
To: SunkenCiv
When did they move Armenia to Poland?..................
5
posted on
03/09/2023 11:18:19 AM PST
by
Red Badger
(Homeless veterans camp in the streets while illegal aliens are put up in hotels.....................)
To: SunkenCiv
That’s like trying to drink whiskey from a bottle of wine ...
6
posted on
03/09/2023 11:21:42 AM PST
by
ClearCase_guy
(“You want it one way, but it's the other way”)
To: SunkenCiv
Ancient Egypt used gold in mummy masks.
The idea was to “purify” the corpse as that person’s spirit was united with Ra, one of their gods.
This practice was most likely done only for the very wealthy.
Pyramid builders were seen as lower class and of little value, so no Mask of Gold for them.
To: BenLurkin
At first glance that looked like a snack / dessert tray. Bagels, wafers, etc.
To: ClearCase_guy
"That’s like trying to drink whiskey from a bottle of wine ..."
trying to find Gold in a Silver mine
To: The Louiswu
"That’s like trying to drink whiskey from a bottle of wine ..." trying to find Gold in a Silver mineOr finding accountability in Washington.
10
posted on
03/09/2023 11:33:16 AM PST
by
1Old Pro
To: SunkenCiv
Z Z Top’s “Pearl necklace” still missing.
To: SunkenCiv
So,they found a little gold when they were scratching about for copper.
12
posted on
03/09/2023 12:03:01 PM PST
by
Leep
(Hillary will NEVER be president! 😁)
To: SunkenCiv
Their version of Rodeo Drive.
wy69
To: BenLurkin; SunkenCiv
ARGH!
I told youse guys not to take that out of the safe again! NOW look!!
‘Face
;o]
14
posted on
03/09/2023 1:40:10 PM PST
by
Monkey Face
( ~~ If you are filled with pride, then you will have no room for wisdom. ~~ African proverb. ~~)
To: BenLurkin
String hadn’t been invented yet?
To: SunkenCiv
Thanks for the reading list, it will last until April. ;-)
16
posted on
03/09/2023 3:11:33 PM PST
by
AdmSmith
(GCTGATATGTCTATGATTACTCAT)
To: Monkey Face
17
posted on
03/10/2023 5:37:59 AM PST
by
SunkenCiv
(Imagine an imaginary menagerie manager imagining managing an imaginary menagerie.)
To: AdmSmith
:^) 2022 appears to have been a year especially rich in Bronze Age topics.
18
posted on
03/10/2023 6:09:00 AM PST
by
SunkenCiv
(Imagine an imaginary menagerie manager imagining managing an imaginary menagerie.)
To: AdmSmith
Would it be more helpful to have an alphabetical list? Please say no.
19
posted on
03/10/2023 6:10:00 AM PST
by
SunkenCiv
(Imagine an imaginary menagerie manager imagining managing an imaginary menagerie.)
To: SunkenCiv
Well, just remember, Spike, youse got a spankin’ comin’!
20
posted on
03/10/2023 6:14:45 AM PST
by
Monkey Face
( ~~ If you are filled with pride, then you will have no room for wisdom. ~~ African proverb. ~~)
Navigation: use the links below to view more comments.
first 1-20, 21 next last
Disclaimer:
Opinions posted on Free Republic are those of the individual
posters and do not necessarily represent the opinion of Free Republic or its
management. All materials posted herein are protected by copyright law and the
exemption for fair use of copyrighted works.
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson