Free Republic
Browse · Search
General/Chat
Topics · Post Article

Skip to comments.

Once thought to be asexual, single-celled parasites caught in the act
Phys.org ^ | June 13, 2019 | Tamara Bhandari, Washington University School of Medicine

Posted on 06/13/2019 5:16:52 PM PDT by ETL

Even single-celled organisms desire partners every now and then.

Leishmania—single-celled parasites that cause infections of the skin and internal organs—have long been known to multiply asexually, like bacteria. But occasionally, researchers have found hybrid parasites that carry from more than one strain—or even more than one species—of Leishmania, suggesting that some kind of genetic mixing is going on.

Now, researchers at Washington University School of Medicine in St. Louis and the National Institutes of Health (NIH) have found that the hybrid Leishmania parasites can mate with one another to produce fertile offspring that carry genes from both parents—signs of a true sexual reproductive cycle. The researchers hope to use their genetic remixing as a tool to find genes involved in virulence in Leishmanial disease.

"What we want to know is why one strain causes a mild form of disease and another causes a lethal form, or how the parasites evade the immune response," said co-senior author Stephen Beverley, Ph.D., a professor of molecular microbiology at the School of Medicine. "By generating offspring with different characteristics, we can identify the genes that cause severe disease or immune resistance. That could be a step toward or prevention."

The findings are available online in PLOS Genetics.

-snip-

By studying the hybrid parasites and their recombined progeny, the researchers will be able to map the location on of genes involved in causing disease and resisting the immune response. Such a genetic map will aid efforts to understand why some strains cause worse disease than others, and how to bolster the to the parasites.

"The good news is we generated offspring with new genetic combinations, which are perfect for our purposes," Beverley said.

"The less good news is we could only obtain a handful, which were enough to establish their fertility, but not quite enough to make a high-resolution map of virulence genes."

The researchers are now trying to figure out why hybrid parasites so rarely succeed at mating.

"If you're a microbe and you have a winning genetic combination that allows you to thrive, you're going to reproduce asexually most of the time, because why mess with a good thing?" Beverley said.

"But even so, you might want to mix things up a bit from time to time, just to see if a new genetic combination can be even more successful. So microbes have mechanisms in place to reshuffle their genetic material via sexual reproduction, but also mechanisms to prevent too much reshuffling so that they can maintain winning genetic combinations and limit inbreeding.

If we can find out what it is that is limiting mating of our experimental hybrid parasites, we will likely uncover something new about the biology of reproduction.

Even better, we may be able to twist it to our own purposes and learn how to create super-fertile hybrid . And then we can use them to find out what we need to know about how they cause disease."


Explore further

Deadly parasite's rare sexual dalliances may help scientists neutralize it


TOPICS: Chit/Chat; Science
KEYWORDS: chimera; dna; godsgravesglyphs; helixmakemineadouble; keywordtroll; leishmania; leishmanialdisease; mtdna; parasite; parasites; science; settledscience; sexualreproduction
Navigation: use the links below to view more comments.
first previous 1-2021-37 last
To: ETL

Apparently. Sheesh.


21 posted on 06/13/2019 6:26:32 PM PDT by Texas Eagle (If it wasn't for double-standards, Liberals would have no standaurds at all -- Texas Eagle)
[ Post Reply | Private Reply | To 14 | View Replies]

To: Professional

“Just like” Romeo & Juliet!


22 posted on 06/13/2019 6:28:10 PM PDT by lee martell
[ Post Reply | Private Reply | To 18 | View Replies]

To: ETL

Settled Science.

Undone.

Again.


23 posted on 06/13/2019 6:33:43 PM PDT by NoLibZone (If the Bible is true America will be damned by God.)
[ Post Reply | Private Reply | To 2 | View Replies]

To: ETL

A “Leishmaniac.” Every teenage boy hopes to meet one.


24 posted on 06/13/2019 6:38:59 PM PDT by ProtectOurFreedom
[ Post Reply | Private Reply | To 1 | View Replies]

To: seawolf101

“If we can find out what it is that is limiting mating...”

Wish they could find that out for humans too.


25 posted on 06/13/2019 6:47:00 PM PDT by Bonemaker (invictus maneo)
[ Post Reply | Private Reply | To 3 | View Replies]

To: ETL
Once thought to be asexual, single-celled parasites caught in the act

Did the offspring look like Webb Hubbell?

26 posted on 06/13/2019 7:18:34 PM PDT by KarlInOhio (Who's the leader of the club that feeds on dead babies? M-O-L... O-C-H... M-O-U-S-E.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: KarlInOhio

Crap I thought this was about Kamela Heels Up Harris. They meant the real single cell animals, not the single brain cell one.


27 posted on 06/13/2019 8:10:20 PM PDT by Equine1952 (Get yourself a ticket on a common mans train of thought. ))
[ Post Reply | Private Reply | To 26 | View Replies]

To: seawolf101

With all this talk of sexual reproduction, they are being binary and heteronormative.

What about the lesbian, gay , bisexual, and transgendered cells and parasites? What about their activities and feelings?


28 posted on 06/13/2019 8:56:54 PM PDT by Dilbert San Diego
[ Post Reply | Private Reply | To 3 | View Replies]

To: StayAt HomeMother; Ernest_at_the_Beach; 1ofmanyfree; 21twelve; 24Karet; 2ndDivisionVet; 31R1O; ...
Thanks ETL.

29 posted on 06/13/2019 10:43:37 PM PDT by SunkenCiv (Imagine an imaginary menagerie manager imagining managing an imaginary menagerie.)
[ Post Reply | Private Reply | View Replies]

To: ETL

Sexual reproductiuon exists in many single cell parasites https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4413856/


30 posted on 06/14/2019 1:04:56 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 1 | View Replies]

and now I see that they had a ref to that paper (29) https://journals.plos.org/plosgenetics/article?id=10.1371/journal.pgen.1008042#references


31 posted on 06/14/2019 1:07:48 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 30 | View Replies]

To: Dilbert San Diego
What about the lesbian, gay, bisexual, and transgendered cells and parasites? What about their activities and feelings?

LOL! Good one!

32 posted on 06/14/2019 1:39:06 AM PDT by ETL (REAL Russia collusion! Newly updated FR Page w/ Table of Contents! Click ETL)
[ Post Reply | Private Reply | To 28 | View Replies]

To: Dilbert San Diego
What about the lesbian, gay, bisexual, and transgendered cells and parasites? What about their activities and feelings?




33 posted on 06/14/2019 1:39:37 AM PDT by ETL (REAL Russia collusion! Newly updated FR Page w/ Table of Contents! Click ETL)
[ Post Reply | Private Reply | To 28 | View Replies]

To: Dilbert San Diego
What about the lesbian, gay, bisexual, and transgendered cells and parasites? What about their activities and feelings?




34 posted on 06/14/2019 1:40:01 AM PDT by ETL (REAL Russia collusion! Newly updated FR Page w/ Table of Contents! Click ETL)
[ Post Reply | Private Reply | To 28 | View Replies]







Related image

35 posted on 06/14/2019 1:45:24 AM PDT by ETL (REAL Russia collusion! Newly updated FR Page w/ Table of Contents! Click ETL)
[ Post Reply | Private Reply | To 28 | View Replies]

To: ETL; SunkenCiv

It was ronery.................


36 posted on 06/14/2019 6:23:33 AM PDT by Red Badger (We are headed for a Civil War. It won't be nice like the last one....................)
[ Post Reply | Private Reply | To 1 | View Replies]

To: ETL

>>>”By generating offspring with different characteristics, we can identify the genes that cause severe disease or immune resistance. That could be a step toward better treatment or prevention.”<<<

...or weaponization.


37 posted on 06/15/2019 8:39:43 PM PDT by ApplegateRanch
[ Post Reply | Private Reply | To 1 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-2021-37 last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
General/Chat
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson