Free Republic
Browse · Search
News/Activism
Topics · Post Article

Skip to comments.

Evolution Challenged in Georgia School Debate
Voice of America ^ | 29 August 2004 | Kate Sweeney

Posted on 08/29/2004 8:07:55 AM PDT by PatrickHenry

It's a simple scientific concept, and perhaps one of the most complex issues in culturally conservative parts of the nation. And nearly eight decades after a teacher in Tennessee went on trial for talking to his class about Darwin's ideas, talk of evolution has taken center-stage in Georgia's public classrooms. Two years ago, the School Board of Cobb County, near Atlanta, voted to place a sticker in the county's science textbooks.

"The disclaimer says, 'This textbook contains material on evolution. Evolution is a theory, not a fact, regarding the origin of living things. This material should be approached with an open mind, studied carefully, and critically considered,'" says attorney Michael Manely who represents a parent group from Cobb County, which has sued the school board, demanding the disclaimer be removed. The group says the county is trying to force religion into the schools.

Cobb County education officials deny that claim, but with countless theories about everything from galaxy formation to cell communication - Mr. Manely is skeptical. "There are well over 5,000 theories that I'm familiar with. So of these 5,000 possible scientific theories: Why has the school board chosen to disclaim only evolution?"

Cobb County Schools declined to comment on the matter, but others were happy to speak out.

"Well, I think the sticker is appropriate," says Barrett Duke, the Vice-President for Public Policy of the Southern Baptist Convention. "I think it's appropriate for students to understand that evolution is a theory; It is not fact."

Mainstream scientists, however, do recognize evolution as a fact, based on fossil records and other biological evidence. They reject the concept put forward by one group of evolution opponents, known as Intelligent Design Theory. Its underlying premise is: if there's a creation, there must be a creator.

For Sarah Pallas, a science professor at Georgia State University, Intelligent Design is not so much a competing theory as a distraction. "I liken these groups, such as Discovery Institute, to schoolyard bullies that are pushing their way to the head of the line," she says. "They don't do laboratory science. They don't spend their millions in private donations on test-tubes or DNA analysis machines, they spend it on their PR machines, pushing on uneducated school board members, to get their ideas into the classroom."

The Discovery Institute, the conservative think-tank [ARRRRGHHH!] behind Intelligent Design, says it does not endorse the theory's inclusion in school curriculum, only the presentation of "scientific weaknesses" it sees in Darwinian evolution.

But there is a moral imperative for conservative groups to get involved in public education matters, according to Graham Walker, a theology professor at Mercer University. He points to what some see as a lack of moral foundation in today's public schools. "We have not provided a basis the way the old 17th and 18th century schooling systems provided it: Whereby you would discuss: 'How should I live?'"

Moreover, the upsurge in the evolution controversy comes as conservative religious groups like the Southern Baptist Convention are facing a more palpable crisis: Barrett Duke says, they're losing followers. "There's no question that many Christian young people are going out to public school and they're coming out much different than their parents had expected them to come out!"

The SBC says that by the time they are 18 years old, nearly 90-percent of the children raised in evangelical homes have left the church, never to return. The attrition problem has Southern Baptist leaders so concerned that earlier this year, prominent members of the church asked their national convention to consider a resolution that would have called on Southern Baptist parents to remove their children from the nation's public schools.

Georgia State science professor Sarah Pallas agrees that U.S. public schools are in real trouble but for exactly the opposite reason than that voiced by the Southern Baptists: not discussing scientific topics like evolution is leading to a decline in test scores and the quality of education and economic potential. "We are losing out on our dominance in this area, in science and technology, and the top scientists, the top-notch discoveries, are now not located in this country anymore, they're located overseas. This is going to be a real economic cost to the state, and to the nation," she says.

But those fears are not shared by conservative Christian leaders like Barrett Duke. "For those of us who believe that God really did create the world," he says, "it seems to me that it would be appropriate to at least give a nod in God's direction!"

Earlier this summer, the State Education Board adopted science curriculum standards based on the goals recommended by the American Association for the Advancement of Science. As classes resume in Georgia, public schools will be held to those standards, which include the teaching of evolution and its related concepts.

The case regarding the disclaimer stickers in Cobb County could go to trial as soon as October.


TOPICS: Culture/Society; Miscellaneous; Philosophy; US: Georgia
KEYWORDS: creationism; crevolist; darwin; evolution; intelligentdesign; scienceeducation
Navigation: use the links below to view more comments.
first previous 1-2021-4041-6061-74 next last
To: Hoplite
... if a duck flew into a beaver, you'd get a platypus.

Ah, a new theory arises to challenge the Darwinian stranglehold on academia -- the catastrophic collision theory of speciation. This indeed deserves equal time in the schools.

21 posted on 08/29/2004 2:27:28 PM PDT by PatrickHenry (A compassionate evolutionist!)
[ Post Reply | Private Reply | To 20 | View Replies]

To: PatrickHenry
"The people who want the disclaimer don't know what evolution is. But they don't like it anyway. Ignorant people shouldn't have their way in such matters."

BS. We know exactly what evolution is. It's that we aren't so ignorant as to accept everthing the evolutionists imagine at face value that has you wanting to silence the debate and present only one side of the facts.

22 posted on 08/29/2004 2:34:37 PM PDT by DannyTN
[ Post Reply | Private Reply | To 8 | View Replies]

To: longshadow

I don't believe the 90%. I'd like to see where they are getting that info.


23 posted on 08/29/2004 2:36:54 PM PDT by DannyTN
[ Post Reply | Private Reply | To 17 | View Replies]

To: PatrickHenry; xzins; Heartlander; Tribune7; Michael_Michaelangelo
"The disclaimer says, 'This textbook contains material on evolution. Evolution is a theory, not a fact, regarding the origin of living things. This material should be approached with an open mind, studied carefully, and critically considered,'" says attorney Michael Manely who represents a parent group from Cobb County, which has sued the school board, demanding the disclaimer be removed. The group says the county is trying to force religion into the schools.

Such compelling logic. A simple label will bring about the demise of freedom, but the icy hand covering the mouths of dissenters will not.

"This textbook contains material on evolution. Evolution is a theory, not a fact, regarding the origin of living things. This material should be approached with an open mind, studied carefully, and critically considered..." = "sermon".

24 posted on 08/29/2004 2:48:32 PM PDT by AndrewC (I am a Bertrand Russell agnostic, even an atheist.</sarcasm>)
[ Post Reply | Private Reply | To 1 | View Replies]

To: DannyTN
I don't believe the 90%. I'd like to see where they are getting that info.

The article specifically attributes the 90% figure to the "SBC," which one would assume means the "Southern Baptist Convention."

25 posted on 08/29/2004 2:56:01 PM PDT by longshadow
[ Post Reply | Private Reply | To 23 | View Replies]

To: longshadow
"The article specifically attributes the 90% figure to the "SBC," which one would assume means the "Southern Baptist Convention."

I know it does, but I am Southern Baptist and I haven't heard that number nor does it match my experience. So I'm wondering if the SBC really said that, who they are quoting. I noticed they didn't attribute that statement to Barrett Duke, so if not him, then who?

26 posted on 08/29/2004 2:59:27 PM PDT by DannyTN
[ Post Reply | Private Reply | To 25 | View Replies]

To: DannyTN
So I'm wondering if the SBC really said that, who they are quoting. I noticed they didn't attribute that statement to Barrett Duke, so if not him, then who?

Check with the VOA, and/or check with the SBC.

27 posted on 08/29/2004 3:02:07 PM PDT by longshadow
[ Post Reply | Private Reply | To 26 | View Replies]

To: PatrickHenry

So are they implying that the National Center for Science Education is a liberal group?


28 posted on 08/29/2004 3:22:02 PM PDT by RightWingAtheist (<A HREF=http://www.michaelmoore.com>stupid blob</A>)
[ Post Reply | Private Reply | To 1 | View Replies]

To: longshadow
"Check with the VOA, and/or check with the SBC."

I just pulled up a site on SBC statistics and learned that numberically we are still growing, but we have lost ground as a percent of total Americans. There are several reasons given for the growth slowing.


29 posted on 08/29/2004 3:30:45 PM PDT by DannyTN
[ Post Reply | Private Reply | To 27 | View Replies]

To: DannyTN
"The article specifically attributes the 90% figure to the "SBC," which one would assume means the "Southern Baptist Convention."

I know it does, but I am Southern Baptist and I haven't heard that number nor does it match my experience. So I'm wondering if the SBC really said that, who they are quoting. I noticed they didn't attribute that statement to Barrett Duke, so if not him, then who?

Here's the only article I found at the Baptist Press site that touches on this: Protestant majority in America disappearing, study indicates. But it doesn't have the 90% figure.
30 posted on 08/29/2004 3:41:04 PM PDT by jennyp (It's a gift........And a curse.)
[ Post Reply | Private Reply | To 26 | View Replies]

To: jennyp
Thanks. Losing 90% of our youth, just can't be right. Maybe they got it turned around that only 90% remain. Alarm bells would be going off big time. Our churches would be dying and growing old and I don't see that they are. I did note that article you posted me said this about protestants in general

"Until 1993, about 90 percent of people who were raised Protestant remained Protestants as adults, but by 2002 the number had fallen to 83 percent, the study said. "

31 posted on 08/29/2004 3:44:33 PM PDT by DannyTN
[ Post Reply | Private Reply | To 30 | View Replies]

To: Physicist
Wrong. Evolution is a theory AND a fact. The theory of evolution is that variations are passed on to offspring, and selected by relative reproductive success. The fact of evolution is that allele frequencies change over time, and have throughout the history of life on Earth. The theory may or may not be correct--the evidence for it is extremely strong--but the fact is irrefutable.

None of that addresses the conversion of inanimate/dead objects into reproducing objects. The disclaimer was narrow, by my read, but misapplied the word "evolution" where the theory of evolution doesn't even tread. The disclaimer says, in part ...

Evolution is a theory, not a fact, regarding the origin of living things.

The disclaimer appears to be focused on the transition from dead to alive, and incorrectly uses the term "evolution" to describe that transition.

32 posted on 08/29/2004 4:02:46 PM PDT by Cboldt
[ Post Reply | Private Reply | To 15 | View Replies]

To: AndrewC; PatrickHenry; VadeRetro; Ichneumon
For evolution to be true requires God to exist, for evolution were true it would have to be a miracle.

The big questions are things like is there a Hell and is our soul eternal.

The point isn't that all life sprang from a single instance of abiogenesis (or not), but what is God's will for us.

33 posted on 08/29/2004 5:06:08 PM PDT by Tribune7
[ Post Reply | Private Reply | To 24 | View Replies]

To: Cboldt
The disclaimer appears to be focused on the transition from dead to alive

So Darwin's On the Origin of the Species is a treatise on abiogenesis?

34 posted on 08/29/2004 5:18:26 PM PDT by Physicist
[ Post Reply | Private Reply | To 32 | View Replies]

To: AndrewC
"This textbook contains material on evolution. Evolution is a theory, not a fact, regarding the origin of living things. This material should be approached with an open mind, studied carefully, and critically considered..." = "sermon".

Come on Andrew, you know that anyone who questions any aspect of evolution ‘must’ be a creationist and they are preaching a sermon because evolution is a 'fact' just like all the other 'facts' in science throughout history. Although many people question evolution as a 'fact' (with the mechanisms provided) including atheists, they ‘must’ be labeled creationist because it makes it easy to persecute.

Any scientist thoughout history that questions aspects of science might as well be labeled a creationist. Hawkings, Newton, Denton, Darwin, Boyle, Crick, Behe, Pascal, Kepler, Bacon, Faraday, Davies, Hoyle, etc… these are all ‘creationists’ and preaching sermons. Why did science even let these charlatans speak?

It’s about time children stopped questioning science and just accept it as truth – although they should all face the east while doing this at least five times a day.

Note: I am only sarcastic in the sense that I could not be more sarcastic.

35 posted on 08/29/2004 5:24:56 PM PDT by Heartlander (I am Heartlander and I approve of this post.)
[ Post Reply | Private Reply | To 24 | View Replies]

To: PatrickHenry
Liberal ARRRRGHHH!-ument --- Conservative Placemarker.

(See C-Span)

36 posted on 08/29/2004 5:40:29 PM PDT by Heartlander (I am Heartlander and I approve of this post.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: PatrickHenry
"Well, I think the sticker is appropriate," says Barrett Duke, the Vice-President for Public Policy of the Southern Baptist Convention. "I think it's appropriate for students to understand that evolution is a theory; It is not fact."

Obviously there are many people in Cobb County who do not understand the meaning scientists give to the word "theory". Perhaps they should read Chapter 1 of the textbook, which more than likely discusses the scientific method.

Meanwhile, it must be confusing to students and infuriating for the science teachers to see "theory" and "hypothesis" used interchangably like this by officials in science class.

37 posted on 08/29/2004 5:45:22 PM PDT by Amelia
[ Post Reply | Private Reply | To 1 | View Replies]

To: PatrickHenry
While attending our local public high school, we had a biology book that taught all life evolved from single celled organisms, perhaps, hundreds of millions of years ago, if not billions of years ago. In fact, the biology book from which I studied in high school contained this aforementioned theory in the Preface. Not only did this Biology book contain this theory, but constantly stated and restated the theory. I attended public school in North Carolina.

There are scientists, who do in fact, regardless of how passionately you evolutionists try to argue otherwise, say evolution explains the basis and existence of all life on Earth. This is the problem all people who argue against evolution have with evolution.

I have been on record as saying many times evolution did not happen, is not happening and could never happen. Life is too complex and intricate to have evolved over a period millions of years. I view scientific evidence the same way I view polls. Any group can make any conclusion come from the evidence they provide depending on what their particular mission is. In other words, evidence and polls can be manipulated to bring a desired conclusion. This concept takes place in our court system on a daily basis, as well as other areas of life. If you do not believe what I have just stated about not just scientific evidence but polls also, then all I can say for you my friend is you are deceived .

I will tell you one thing I know to be fact. There is a God in Heaven. He sent His only begotten Son to this Earth to die for us. His Son did in fact die on the cross on Calvary, He rose again on the Third Day. Jesus is His Name. Some day the eastern sky IS going to split. We ALL are going to stand before Him in judgment. All things that are secret will be made known, and all things known will be made secret. One day every knee shall bow and every tongue confess that Jesus Christ Is Lord!!! On that day, we will learn absolutely, that God Himself breathed life in to man, and formed all life in the Palm of His Hand.

I know criticism of all kinds are coming my way the very minute this gets posted. Let the criticisms come, I would rather be criticized and right, than supported and wrong. With all of that said, the disclaimer should have included ALL of the theories contained in the science book used by the Cobb County Public School System. The disclaimer in no way, shape or form even mentioned religion; and yet, somehow, not only have you good folks leaped a huge leap to say this disclaimer pushes religion, so does the group filing the suit. Man has completely ignored the existence of God, and replaced Him with evolution and all kinds of other ideas, and then have the audacity to wonder why our country is in such a shocking state of moral decay. Will the irony ever cease???
38 posted on 08/29/2004 6:33:20 PM PDT by ChevyZ28 ( For I know the thoughts I have for you says the Lord, thoughts of peace, not of evil.. Jer. 29:11)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Cboldt
Astrophysics is a theory, not a fact, regarding the origin of matter.

Why is there no demand for this disclaimer?

39 posted on 08/29/2004 7:12:50 PM PDT by Oztrich Boy ("Despise not the jester. Often he is the only one speaking the truth")
[ Post Reply | Private Reply | To 4 | View Replies]

To: PatrickHenry

ATTAATACTGAACTCCTTATTGGTGAGAATACCGACGAGTCAATCGGAAACATAAGCAATACCAGCTGTATAGAGAATTGTGAA


40 posted on 08/29/2004 8:55:43 PM PDT by rmmcdaniell
[ Post Reply | Private Reply | To 1 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-2021-4041-6061-74 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
News/Activism
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson