Evolution Challenged in Georgia School Debate

Voice of America ^ | 29 August 2004 | Kate Sweeney

[PatrickHenry]

... if a duck flew into a beaver, you'd get a platypus.

Ah, a new theory arises to challenge the Darwinian stranglehold on academia -- the catastrophic collision theory of speciation. This indeed deserves equal time in the schools.

[DannyTN]

"The people who want the disclaimer don't know what evolution is. But they don't like it anyway. Ignorant people shouldn't have their way in such matters."

BS. We know exactly what evolution is. It's that we aren't so ignorant as to accept everthing the evolutionists imagine at face value that has you wanting to silence the debate and present only one side of the facts.

[DannyTN]

I don't believe the 90%. I'd like to see where they are getting that info.

[AndrewC]

"The disclaimer says, 'This textbook contains material on evolution. Evolution is a theory, not a fact, regarding the origin of living things. This material should be approached with an open mind, studied carefully, and critically considered,'" says attorney Michael Manely who represents a parent group from Cobb County, which has sued the school board, demanding the disclaimer be removed. The group says the county is trying to force religion into the schools.

Such compelling logic. A simple label will bring about the demise of freedom, but the icy hand covering the mouths of dissenters will not.

"This textbook contains material on evolution. Evolution is a theory, not a fact, regarding the origin of living things. This material should be approached with an open mind, studied carefully, and critically considered..." = "sermon".

[longshadow]

I don't believe the 90%. I'd like to see where they are getting that info.

The article specifically attributes the 90% figure to the "SBC," which one would assume means the "Southern Baptist Convention."

[DannyTN]

"The article specifically attributes the 90% figure to the "SBC," which one would assume means the "Southern Baptist Convention."

I know it does, but I am Southern Baptist and I haven't heard that number nor does it match my experience. So I'm wondering if the SBC really said that, who they are quoting. I noticed they didn't attribute that statement to Barrett Duke, so if not him, then who?

[longshadow]

So I'm wondering if the SBC really said that, who they are quoting. I noticed they didn't attribute that statement to Barrett Duke, so if not him, then who?

Check with the VOA, and/or check with the SBC.

[RightWingAtheist]

So are they implying that the National Center for Science Education is a liberal group?

[DannyTN]

"Check with the VOA, and/or check with the SBC."

I just pulled up a site on SBC statistics and learned that numberically we are still growing, but we have lost ground as a percent of total Americans. There are several reasons given for the growth slowing.

• There is the well publicized split between the SBC and the moderates. But there weren't that many moderates.
• Some Baptist churches are dropping the name "Baptist" because they view as associated with bigotry (From the slavery days) and because there is a growing trend of people rejecting organized denominations in general and opting for "non-denominational" churches, which have effectively become a denomination unto themselves.
• I don't doubt that we lose some youth, we always have, but I really doubt we lose anything like 90%. My guess is 9%.

[jennyp]

"The article specifically attributes the 90% figure to the "SBC," which one would assume means the "Southern Baptist Convention."

I know it does, but I am Southern Baptist and I haven't heard that number nor does it match my experience. So I'm wondering if the SBC really said that, who they are quoting. I noticed they didn't attribute that statement to Barrett Duke, so if not him, then who?

Here's the only article I found at the Baptist Press site that touches on this: Protestant majority in America disappearing, study indicates. But it doesn't have the 90% figure.

[DannyTN]

Thanks. Losing 90% of our youth, just can't be right. Maybe they got it turned around that only 90% remain. Alarm bells would be going off big time. Our churches would be dying and growing old and I don't see that they are. I did note that article you posted me said this about protestants in general

"Until 1993, about 90 percent of people who were raised Protestant remained Protestants as adults, but by 2002 the number had fallen to 83 percent, the study said. "

[Cboldt]

Wrong. Evolution is a theory AND a fact. The theory of evolution is that variations are passed on to offspring, and selected by relative reproductive success. The fact of evolution is that allele frequencies change over time, and have throughout the history of life on Earth. The theory may or may not be correct--the evidence for it is extremely strong--but the fact is irrefutable.

None of that addresses the conversion of inanimate/dead objects into reproducing objects. The disclaimer was narrow, by my read, but misapplied the word "evolution" where the theory of evolution doesn't even tread. The disclaimer says, in part ...

Evolution is a theory, not a fact, regarding the origin of living things.

The disclaimer appears to be focused on the transition from dead to alive, and incorrectly uses the term "evolution" to describe that transition.

[Tribune7]

For evolution to be true requires God to exist, for evolution were true it would have to be a miracle.

The big questions are things like is there a Hell and is our soul eternal.

The point isn't that all life sprang from a single instance of abiogenesis (or not), but what is God's will for us.

[Physicist]

The disclaimer appears to be focused on the transition from dead to alive

So Darwin's On the Origin of the Species is a treatise on abiogenesis?

[Heartlander]

"This textbook contains material on evolution. Evolution is a theory, not a fact, regarding the origin of living things. This material should be approached with an open mind, studied carefully, and critically considered..." = "sermon".

Come on Andrew, you know that anyone who questions any aspect of evolution ‘must’ be a creationist and they are preaching a sermon because evolution is a 'fact' just like all the other 'facts' in science throughout history. Although many people question evolution as a 'fact' (with the mechanisms provided) including atheists, they ‘must’ be labeled creationist because it makes it easy to persecute.

Any scientist thoughout history that questions aspects of science might as well be labeled a creationist. Hawkings, Newton, Denton, Darwin, Boyle, Crick, Behe, Pascal, Kepler, Bacon, Faraday, Davies, Hoyle, etc… these are all ‘creationists’ and preaching sermons. Why did science even let these charlatans speak?

It’s about time children stopped questioning science and just accept it as truth – although they should all face the east while doing this at least five times a day.

Note: I am only sarcastic in the sense that I could not be more sarcastic.

[Heartlander]

Liberal ARRRRGHHH!-ument --- Conservative Placemarker.

(See C-Span)

[Amelia]

"Well, I think the sticker is appropriate," says Barrett Duke, the Vice-President for Public Policy of the Southern Baptist Convention. "I think it's appropriate for students to understand that evolution is a theory; It is not fact."

Obviously there are many people in Cobb County who do not understand the meaning scientists give to the word "theory". Perhaps they should read Chapter 1 of the textbook, which more than likely discusses the scientific method.

Meanwhile, it must be confusing to students and infuriating for the science teachers to see "theory" and "hypothesis" used interchangably like this by officials in science class.

[ChevyZ28]

While attending our local public high school, we had a biology book that taught all life evolved from single celled organisms, perhaps, hundreds of millions of years ago, if not billions of years ago. In fact, the biology book from which I studied in high school contained this aforementioned theory in the Preface. Not only did this Biology book contain this theory, but constantly stated and restated the theory. I attended public school in North Carolina.

There are scientists, who do in fact, regardless of how passionately you evolutionists try to argue otherwise, say evolution explains the basis and existence of all life on Earth. This is the problem all people who argue against evolution have with evolution.

I have been on record as saying many times evolution did not happen, is not happening and could never happen. Life is too complex and intricate to have evolved over a period millions of years. I view scientific evidence the same way I view polls. Any group can make any conclusion come from the evidence they provide depending on what their particular mission is. In other words, evidence and polls can be manipulated to bring a desired conclusion. This concept takes place in our court system on a daily basis, as well as other areas of life. If you do not believe what I have just stated about not just scientific evidence but polls also, then all I can say for you my friend is you are deceived .

I will tell you one thing I know to be fact. There is a God in Heaven. He sent His only begotten Son to this Earth to die for us. His Son did in fact die on the cross on Calvary, He rose again on the Third Day. Jesus is His Name. Some day the eastern sky IS going to split. We ALL are going to stand before Him in judgment. All things that are secret will be made known, and all things known will be made secret. One day every knee shall bow and every tongue confess that Jesus Christ Is Lord!!! On that day, we will learn absolutely, that God Himself breathed life in to man, and formed all life in the Palm of His Hand.

I know criticism of all kinds are coming my way the very minute this gets posted. Let the criticisms come, I would rather be criticized and right, than supported and wrong. With all of that said, the disclaimer should have included ALL of the theories contained in the science book used by the Cobb County Public School System. The disclaimer in no way, shape or form even mentioned religion; and yet, somehow, not only have you good folks leaped a huge leap to say this disclaimer pushes religion, so does the group filing the suit. Man has completely ignored the existence of God, and replaced Him with evolution and all kinds of other ideas, and then have the audacity to wonder why our country is in such a shocking state of moral decay. Will the irony ever cease???

[Oztrich Boy]

Astrophysics is a theory, not a fact, regarding the origin of matter.

Why is there no demand for this disclaimer?

[rmmcdaniell]

ATTAATACTGAACTCCTTATTGGTGAGAATACCGACGAGTCAATCGGAAACATAAGCAATACCAGCTGTATAGAGAATTGTGAA