Posted on 08/29/2004 8:07:55 AM PDT by PatrickHenry
It's a simple scientific concept, and perhaps one of the most complex issues in culturally conservative parts of the nation. And nearly eight decades after a teacher in Tennessee went on trial for talking to his class about Darwin's ideas, talk of evolution has taken center-stage in Georgia's public classrooms. Two years ago, the School Board of Cobb County, near Atlanta, voted to place a sticker in the county's science textbooks.
"The disclaimer says, 'This textbook contains material on evolution. Evolution is a theory, not a fact, regarding the origin of living things. This material should be approached with an open mind, studied carefully, and critically considered,'" says attorney Michael Manely who represents a parent group from Cobb County, which has sued the school board, demanding the disclaimer be removed. The group says the county is trying to force religion into the schools.
Cobb County education officials deny that claim, but with countless theories about everything from galaxy formation to cell communication - Mr. Manely is skeptical. "There are well over 5,000 theories that I'm familiar with. So of these 5,000 possible scientific theories: Why has the school board chosen to disclaim only evolution?"
Cobb County Schools declined to comment on the matter, but others were happy to speak out.
"Well, I think the sticker is appropriate," says Barrett Duke, the Vice-President for Public Policy of the Southern Baptist Convention. "I think it's appropriate for students to understand that evolution is a theory; It is not fact."
Mainstream scientists, however, do recognize evolution as a fact, based on fossil records and other biological evidence. They reject the concept put forward by one group of evolution opponents, known as Intelligent Design Theory. Its underlying premise is: if there's a creation, there must be a creator.
For Sarah Pallas, a science professor at Georgia State University, Intelligent Design is not so much a competing theory as a distraction. "I liken these groups, such as Discovery Institute, to schoolyard bullies that are pushing their way to the head of the line," she says. "They don't do laboratory science. They don't spend their millions in private donations on test-tubes or DNA analysis machines, they spend it on their PR machines, pushing on uneducated school board members, to get their ideas into the classroom."
The Discovery Institute, the conservative think-tank [ARRRRGHHH!] behind Intelligent Design, says it does not endorse the theory's inclusion in school curriculum, only the presentation of "scientific weaknesses" it sees in Darwinian evolution.
But there is a moral imperative for conservative groups to get involved in public education matters, according to Graham Walker, a theology professor at Mercer University. He points to what some see as a lack of moral foundation in today's public schools. "We have not provided a basis the way the old 17th and 18th century schooling systems provided it: Whereby you would discuss: 'How should I live?'"
Moreover, the upsurge in the evolution controversy comes as conservative religious groups like the Southern Baptist Convention are facing a more palpable crisis: Barrett Duke says, they're losing followers. "There's no question that many Christian young people are going out to public school and they're coming out much different than their parents had expected them to come out!"
The SBC says that by the time they are 18 years old, nearly 90-percent of the children raised in evangelical homes have left the church, never to return. The attrition problem has Southern Baptist leaders so concerned that earlier this year, prominent members of the church asked their national convention to consider a resolution that would have called on Southern Baptist parents to remove their children from the nation's public schools.
Georgia State science professor Sarah Pallas agrees that U.S. public schools are in real trouble but for exactly the opposite reason than that voiced by the Southern Baptists: not discussing scientific topics like evolution is leading to a decline in test scores and the quality of education and economic potential. "We are losing out on our dominance in this area, in science and technology, and the top scientists, the top-notch discoveries, are now not located in this country anymore, they're located overseas. This is going to be a real economic cost to the state, and to the nation," she says.
But those fears are not shared by conservative Christian leaders like Barrett Duke. "For those of us who believe that God really did create the world," he says, "it seems to me that it would be appropriate to at least give a nod in God's direction!"
Earlier this summer, the State Education Board adopted science curriculum standards based on the goals recommended by the American Association for the Advancement of Science. As classes resume in Georgia, public schools will be held to those standards, which include the teaching of evolution and its related concepts.
The case regarding the disclaimer stickers in Cobb County could go to trial as soon as October.
Ah, a new theory arises to challenge the Darwinian stranglehold on academia -- the catastrophic collision theory of speciation. This indeed deserves equal time in the schools.
BS. We know exactly what evolution is. It's that we aren't so ignorant as to accept everthing the evolutionists imagine at face value that has you wanting to silence the debate and present only one side of the facts.
I don't believe the 90%. I'd like to see where they are getting that info.
Such compelling logic. A simple label will bring about the demise of freedom, but the icy hand covering the mouths of dissenters will not.
"This textbook contains material on evolution. Evolution is a theory, not a fact, regarding the origin of living things. This material should be approached with an open mind, studied carefully, and critically considered..." = "sermon".
The article specifically attributes the 90% figure to the "SBC," which one would assume means the "Southern Baptist Convention."
I know it does, but I am Southern Baptist and I haven't heard that number nor does it match my experience. So I'm wondering if the SBC really said that, who they are quoting. I noticed they didn't attribute that statement to Barrett Duke, so if not him, then who?
Check with the VOA, and/or check with the SBC.
So are they implying that the National Center for Science Education is a liberal group?
I just pulled up a site on SBC statistics and learned that numberically we are still growing, but we have lost ground as a percent of total Americans. There are several reasons given for the growth slowing.
"The article specifically attributes the 90% figure to the "SBC," which one would assume means the "Southern Baptist Convention."Here's the only article I found at the Baptist Press site that touches on this: Protestant majority in America disappearing, study indicates. But it doesn't have the 90% figure.I know it does, but I am Southern Baptist and I haven't heard that number nor does it match my experience. So I'm wondering if the SBC really said that, who they are quoting. I noticed they didn't attribute that statement to Barrett Duke, so if not him, then who?
"Until 1993, about 90 percent of people who were raised Protestant remained Protestants as adults, but by 2002 the number had fallen to 83 percent, the study said. "
None of that addresses the conversion of inanimate/dead objects into reproducing objects. The disclaimer was narrow, by my read, but misapplied the word "evolution" where the theory of evolution doesn't even tread. The disclaimer says, in part ...
Evolution is a theory, not a fact, regarding the origin of living things.
The disclaimer appears to be focused on the transition from dead to alive, and incorrectly uses the term "evolution" to describe that transition.
The big questions are things like is there a Hell and is our soul eternal.
The point isn't that all life sprang from a single instance of abiogenesis (or not), but what is God's will for us.
So Darwin's On the Origin of the Species is a treatise on abiogenesis?
Come on Andrew, you know that anyone who questions any aspect of evolution must be a creationist and they are preaching a sermon because evolution is a 'fact' just like all the other 'facts' in science throughout history. Although many people question evolution as a 'fact' (with the mechanisms provided) including atheists, they must be labeled creationist because it makes it easy to persecute.
Any scientist thoughout history that questions aspects of science might as well be labeled a creationist. Hawkings, Newton, Denton, Darwin, Boyle, Crick, Behe, Pascal, Kepler, Bacon, Faraday, Davies, Hoyle, etc these are all creationists and preaching sermons. Why did science even let these charlatans speak?
Its about time children stopped questioning science and just accept it as truth although they should all face the east while doing this at least five times a day.
Note: I am only sarcastic in the sense that I could not be more sarcastic.
(See C-Span)
Obviously there are many people in Cobb County who do not understand the meaning scientists give to the word "theory". Perhaps they should read Chapter 1 of the textbook, which more than likely discusses the scientific method.
Meanwhile, it must be confusing to students and infuriating for the science teachers to see "theory" and "hypothesis" used interchangably like this by officials in science class.
Why is there no demand for this disclaimer?
ATTAATACTGAACTCCTTATTGGTGAGAATACCGACGAGTCAATCGGAAACATAAGCAATACCAGCTGTATAGAGAATTGTGAA
Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.