Free Republic
Browse · Search
General/Chat
Topics · Post Article

Skip to comments.

Ancient DNA Pinpoints Culprit Responsible for World's First Pandemic
Archaeology Magazine ^ | September 5, 2025 | editors / unattributed

Posted on 09/08/2025 7:14:56 AM PDT by SunkenCiv

The world's first pandemic, known as the Plague of Justinian after the sitting Byzantine emperor, killed an estimated 25 to 100 million people between a.d. 541 and 750... historical sources from the period suggest that it may have begun around Pelusium, Egypt, before spreading rapidly throughout the Middle East and the Mediterranean world. According to a statement released by the University of South Florida (USF), researchers participated in an interdisciplinary study that has uncovered -- for the first time -- direct genomic evidence pinpointing the bacterium Yersinia pestis as the cause of the plague. The team sequenced genetic material from eight human teeth taken from individuals buried in a mid-sixth to early seventh-century a.d. mass grave beneath the former Roman hippodrome in Jerash, Jordan, a city just 200 miles from ancient Pelusium. The study determined that the plague victims carried nearly identical strains of Y. pestis, confirming for the first time that the microbe was present within the Byzantine Empire between a.d. 550 and 660. "For centuries, we've relied on written accounts describing a devastating disease, but lacked any hard biological evidence of plague's presence," said USF researcher Rays H.Y. Jiang. "Our findings provide the missing piece of that puzzle, offering the first direct genetic window into how this pandemic unfolded at the heart of the empire." Yersinia pestis was also responsible for causing the infamous Black Death, which may have wiped out as much as 50 percent of Europe's population in the fourteenth century. Read the original scholarly article about this research in Genes. To read about evidence of a virulent form of the bacterium that circulated as early as 1800 b.c., go to "Bronze Age PlagueBronze Age Plague," one of ARCHAEOLOGY's Top 10 Discoveries of 2018.

(Excerpt) Read more at archaeology.org ...


TOPICS: History; Science; Travel
KEYWORDS: blackdeath; blackplague; byzantineempire; epigraphyandlanguage; godsgravesglyphs; helixmakemineadouble; hippodrome; jerash; jordan; plagueofjustinian; romanempire; yersiniapestis
Navigation: use the links below to view more comments.
first 1-20, 21-25 next last
Tooth from Jerash
University of South Florida
University of South Florida

1 posted on 09/08/2025 7:14:56 AM PDT by SunkenCiv
[ Post Reply | Private Reply | View Replies]

To: StayAt HomeMother; Ernest_at_the_Beach; 1ofmanyfree; 21twelve; 24Karet; 2ndDivisionVet; 31R1O; ...

2 posted on 09/08/2025 7:16:02 AM PDT by SunkenCiv (NeverTrumpin' -- it's not just for DNC shills anymore -- oh, wait, yeah it is.)
[ Post Reply | Private Reply | View Replies]

To: SunkenCiv

https://en.wikipedia.org/wiki/Yersinia_pestis


3 posted on 09/08/2025 7:23:03 AM PDT by Red Badger (Homeless veterans camp in the streets while illegals are put up in 5 Star hotels....................)
[ Post Reply | Private Reply | To 1 | View Replies]

To: SunkenCiv

“Yersinia pestis was also responsible for causing the infamous Black Death”

This is in error - should read: “Yersinia pestis was also responsible for causing Democrats”


4 posted on 09/08/2025 7:30:23 AM PDT by Afterguard (Deplorable, garbage me. Trump is a threat to bureaucracy.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: SunkenCiv

Related
800-year-old graves pinpoint where the Black Death began Ancient DNA from cemeteries in today’s Kyrgyzstan reveal earliest known victims of 14th century plague.

The Syriac engraving on the medieval tombstone was tantalizing: “This is the tomb of the believer Sanmaq. [He] died of pestilence.” Sanmaq, who was buried in 1338 near Lake Issyk Kul in what is now northern Kyrgyzstan, was one of many victims of the unnamed plague. By scrutinizing field notes and more photos from the Russian team that had excavated the graves in the 1880s, historian Philip Slavin found that at least 118 people from Sanmaq’s Central Asian trading community died in the epidemic.
https://www.science.org/content/article/800-year-old-graves-pinpoint-where-black-death-began


5 posted on 09/08/2025 7:32:57 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 2 | View Replies]

To: Red Badger

6 posted on 09/08/2025 7:36:19 AM PDT by SunkenCiv (NeverTrumpin' -- it's not just for DNC shills anymore -- oh, wait, yeah it is.)
[ Post Reply | Private Reply | To 3 | View Replies]

To: Afterguard

The name Yersinia Pestis name is probably registered as a Democrat in every precinct in the US.


7 posted on 09/08/2025 7:37:22 AM PDT by SunkenCiv (NeverTrumpin' -- it's not just for DNC shills anymore -- oh, wait, yeah it is.)
[ Post Reply | Private Reply | To 4 | View Replies]

To: SunkenCiv

Wikipedia says something interesting: https://en.wikipedia.org/wiki/Plague_of_Justinian

Earlier samples of Yersinia pestis DNA have been found in skeletons dating from 3000 to 800 BC, across West and East Eurasia.[43] The strain of Yersinia pestis responsible for the Black Death, the devastating pandemic of bubonic plague, does not appear to be a direct descendant of the Justinian plague strain. However, the spread of Justinian plague may have caused the evolutionary radiation that gave rise to the currently extant 0ANT.1 clade of strains.


8 posted on 09/08/2025 7:38:10 AM PDT by Doctor Congo
[ Post Reply | Private Reply | To 2 | View Replies]

To: SunkenCiv

Best book about the plague;

A Distant Mirror, The Calamitous Fourteenth Century

Author Barbara Tuchman, circa 1978 or 1979.

Extremely well researched, she also wrote The Guns of August, circa 1961, about the origins of World War One.


9 posted on 09/08/2025 8:13:27 AM PDT by Thapsus_epiphany (Socialism is a prison, Communism is a death camp )
[ Post Reply | Private Reply | To 1 | View Replies]

To: Doctor Congo

Thx!


10 posted on 09/08/2025 8:16:27 AM PDT by SunkenCiv (NeverTrumpin' -- it's not just for DNC shills anymore -- oh, wait, yeah it is.)
[ Post Reply | Private Reply | To 8 | View Replies]

Plague of Justinian and Justinian Plague keywords, sorted:

11 posted on 09/08/2025 8:16:48 AM PDT by SunkenCiv (NeverTrumpin' -- it's not just for DNC shills anymore -- oh, wait, yeah it is.)
[ Post Reply | Private Reply | View Replies]

To: SunkenCiv; All

They buried the lede. The disease vector originated in China.


12 posted on 09/08/2025 8:19:28 AM PDT by nwrep
[ Post Reply | Private Reply | To 1 | View Replies]

To: AdmSmith

It was more than just that they found the earliest known, the virus itself was a parent form that hadn’t mutated, pristine. So it’s pretty much a smoking gun that those Kygrsystanfijdfls were the first effected. I guess since it ended up hittting everyone else eventually anyway they got off easy dying before before all the economic and social disasters hit.


13 posted on 09/08/2025 8:27:36 AM PDT by pepsi_junkie ("We want no Gestapo or Secret Police. F. B. I. is tending in that direction." - Harry S Truman)
[ Post Reply | Private Reply | To 5 | View Replies]

To: pepsi_junkie

FYI...
Yersinia pestis is a bacterium...not a virus.
Freegards.


14 posted on 09/08/2025 8:50:43 AM PDT by Getready (Wisdom is more valuable than gold and harder to find. )
[ Post Reply | Private Reply | To 13 | View Replies]

To: Doctor Congo

Microbes have much shorter generations, which must make it more difficult to determine a parsimonious descent tree.


15 posted on 09/08/2025 9:05:58 AM PDT by SunkenCiv (NeverTrumpin' -- it's not just for DNC shills anymore -- oh, wait, yeah it is.)
[ Post Reply | Private Reply | To 8 | View Replies]

To: SunkenCiv

https://en.wikipedia.org/wiki/Yersinia_pestis

~~~~~
Y. pestis is a facultative anaerobic parasitic bacterium that can infect humans primarily via its host the Oriental rat flea
~~~~~

The Holy Roman empire was composed of grain farming communes. As with all grain farming communes HRE had rats in abundance.


16 posted on 09/08/2025 9:09:19 AM PDT by nagant
[ Post Reply | Private Reply | To 1 | View Replies]

To: Getready
Yersinia pestis is a bacterium...not a virus.

Is there a cure for it?

17 posted on 09/08/2025 9:12:55 AM PDT by painter ( Isaiah: �Woe to those who call evil good and good evil,")
[ Post Reply | Private Reply | To 14 | View Replies]

To: Getready

Of course it is. Sloppy language on my part. thanks for correction.


18 posted on 09/08/2025 9:16:06 AM PDT by pepsi_junkie ("We want no Gestapo or Secret Police. F. B. I. is tending in that direction." - Harry S Truman)
[ Post Reply | Private Reply | To 14 | View Replies]

To: nagant

Occasional recent diagnoses in the US have been related to dogs and cats kept as pets, same wheelhouse.


19 posted on 09/08/2025 9:33:34 AM PDT by SunkenCiv (NeverTrumpin' -- it's not just for DNC shills anymore -- oh, wait, yeah it is.)
[ Post Reply | Private Reply | To 16 | View Replies]

To: Thapsus_epiphany

I have those, uh, around here somewhere. I got the audiobook of Distant Mirror out of the library years ago and got bogged down in the description of the 100 years war warriors and their history. Probably should have bounced into some later chapter disks. Or, just ripped it into MP3 for later.


20 posted on 09/08/2025 9:37:44 AM PDT by SunkenCiv (NeverTrumpin' -- it's not just for DNC shills anymore -- oh, wait, yeah it is.)
[ Post Reply | Private Reply | To 9 | View Replies]


Navigation: use the links below to view more comments.
first 1-20, 21-25 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
General/Chat
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson