Free Republic
Browse · Search
General/Chat
Topics · Post Article

Skip to comments.

A 79-year-old mathematician may have just solved an infinite dimension puzzle that's vexed theorists for decades
SPACE.com ^ | Nathan Brownlowe

Posted on 07/09/2023 1:35:35 PM PDT by nickcarraway

Mathematician Per Enflo, who solved a huge chunk of the 'invariant subspaces problem' decades ago, may have just finished his work.

This article was originally published at The Conversation. The publication contributed the article to Space.com's Expert Voices: Op-Ed & Insights.

Nathan Brownlowe, Senior Lecturer in the School of Mathematics and Statistics at the University of Sydney.

Two weeks ago, a modest-looking paper was uploaded to the arXiv preprint server with the unassuming title "On the invariant subspace problem in Hilbert spaces". The paper is just 13 pages long and its list of references contains only a single entry.

The paper purports to contain the final piece of a jigsaw puzzle that mathematicians have been picking away at for more than half a century: the invariant subspace problem.

Famous open problems often attract ambitious attempts at solutions by interesting characters out to make their name. But such efforts are usually quickly shot down by experts.

However, the author of this short note, Swedish mathematician Per Enflo, is no ambitious up-and-comer. He is almost 80, has made a name for himself solving open problems, and has quite a history with the problem at hand.

Born in 1944 and now an emeritus professor at Kent State University, Ohio, Enflo has had a remarkable career, not only in mathematics but also in music.

He is a renowned concert pianist who has performed and recorded numerous piano concertos, and has performed solo and with orchestras across the world.

Enflo is also one of the great problem-solvers in a field called functional analysis. Aside from his work on the invariant subspace problem, Enflo solved two other major problems – the basis problem and the approximation problem – both of which had remained open for more than 40 years.

By solving the approximation problem, Enflo cracked an equivalent puzzle called Mazur’s goose problem. Polish mathematician Stanisław Mazur had in 1936 promised a live goose to anyone who solved his problem – and in 1972 he kept his word, presenting the goose to Enflo.

black and white photograph of Per Enflo holding a basket with a goose inside.

In 1972, Per Enflo (right) collected the prize of a live goose from Polish mathematician Stanislaw Mazur (left) for solving a particularly difficult problem. (Image credit:The original uploader was Stako at Polish Wikipedia., Public domain, via Wikimedia Commons) What's an invariant subspace?

Now we know the main character. But what about the invariant subspace problem itself?

If you’ve ever taken a first-year university course in linear algebra, you will have come across things called vectors, matrices and eigenvectors. If you haven’t, we can think of a vector as an arrow with a length and a direction, living in a particular vector space. (There are lots of different vector spaces with different numbers of dimensions and various rules.)

Read more: Explainer: the point of pure mathematics

A matrix is something that can transform a vector, by changing the direction and/or length of the line. If a particular matrix only transforms the length of a particular vector (meaning the direction is either the same or flipped in the opposite direction), we call the vector an eigenvector of the matrix.

Another way to think about this is to say that the matrix transforms the eigenvectors (and any lines parallel to them) back onto themselves: these lines are invariant for this matrix. Taken together, we call these lines invariant subspaces of the matrix.

Eigenvectors and invariant subspaces are also of interest beyond just mathematics – to take one example, it has been said that Google owes its success to “the $25 billion eigenvector”.

Diagram of a detailing that a vector is an eigenvector of the matrix.

What about spaces with an infinite number of dimensions?

So that’s an invariant subspace. The invariant subspace problem is a little more complicated: it is about spaces with an infinite number of dimensions, and it asks whether every linear operator (the equivalent of a matrix) in those spaces must have an invariant subspace.

More precisely (hold onto your hat): the invariant subspace problem asks whether every bounded linear operator T on a complex Banach space X admits a non-trivial invariant subspace M of X, in the sense that there is a subspace M ≠ {0}, X of X such that T(M) is contained back in M.

Stated in this way, the invariant subspace problem was posed during the middle of last century, and eluded all attempts at a solution.

Read more: Pythagoras’ revenge: humans didn’t invent mathematics, it’s what the world is made of

But as is often the case when mathematicians can’t solve a problem, we move the goalposts. Mathematicians working on this problem narrowed their focus by restricting the problem to particular classes of spaces and operators.

The first breakthrough was made by Enflo in the 1970s (although his result was not published until 1987). He answered the problem in the negative, by constructing an operator on a Banach space without a non-trivial invariant subspace.

What’s new about this new proposed solution? So what is the current status of the invariant subspace problem? If Enflo solved it in 1987, why has he solved it again?

Well, Enflo settled the problem for Banach spaces in general. However, there is a particularly important kind of Banach space called a Hilbert space, which has a strong sense of geometry and is widely used in physics, economics and applied mathematics.

Resolving the invariant subspace problem for operators on Hilbert spaces has been stubbornly difficult, and it is this which Enflo claims to have achieved.

This time Enflo answers in the affirmative: his paper argues that every bounded linear operator on a Hilbert space does have an invariant subspace.

Expert review is still to come

I have not worked through Enflo’s preprint line by line. Enflo himself is reportedly cautious about the solution, as it has not yet been reviewed by experts.

Peer review of Enflo’s earlier proof, for Banach spaces in general, took several years. However, that paper ran to more than 100 pages, so a review of the 13 pages of the new paper should be much speedier.

If correct, it will be a remarkable achievement, especially for someone who has already produced so many remarkable achievements over such a large span of time. Enflo’s many contributions to mathematics, and his answers to many open problems, have made a big impact on the field, generating new techniques and ideas.

I’m looking forward to finding out whether Enflo’s work now closes the book on the invariant subspace problem, and to seeing the new mathematics that may emerge out of its conclusion.

This article is republished from The Conversation under a Creative Commons license. Read the original article.

Follow all of the Expert Voices issues and debates — and become part of the discussion — on Facebook and Twitter. The views expressed are those of the author and do not necessarily reflect the views of the publisher. Follow us on Twitter @Spacedotcom or on Facebook.


TOPICS: Astronomy; Computers/Internet; Education; Science
KEYWORDS: astronomy; banachspace; banachspaces; geometry; hilbertspaces; invariantsubspace; jigsawpuzzle; mathematics; perenflo; physics; science; stringtheory
Navigation: use the links below to view more comments.
first previous 1-2021-4041-49 last
To: nickcarraway

41 posted on 07/09/2023 4:44:01 PM PDT by Bratch
[ Post Reply | Private Reply | To 1 | View Replies]

To: Fester Chugabrew

I thought I was the only left handed with those characteristics.


42 posted on 07/09/2023 5:08:27 PM PDT by wally_bert (I cannot be sure for certain, but in my personal opinion I am certain that I am not sure..)
[ Post Reply | Private Reply | To 16 | View Replies]

To: Bratch

Numbers were never meant to be included with my brain. I’ve always been a word person. I managed somehow to ern a Master’s degree without as little numbers courses. It never seemed to hold me back. Now I can’t recall even the words, much less numbers. I just read and forget it.


43 posted on 07/09/2023 5:11:49 PM PDT by WVNan
[ Post Reply | Private Reply | To 41 | View Replies]

To: Billthedrill

44 posted on 07/09/2023 5:12:29 PM PDT by gundog (It was a bright cold day in April, and the clocks were striking thirteen. )
[ Post Reply | Private Reply | To 40 | View Replies]

To: nickcarraway

Note: in the body of the text are two contradictory statement. One is an obviously copied text link that states that”man didn’t invent math...it is what we are made of” or something close to that.
The other statement says that “when mathematicians can’t solve a problem, they move the goalposts” So, they invent a new math. How is it “what the world is made of” if we have to invent a new version? We clearly are “inventing” something that is not part of the world.
QED


45 posted on 07/09/2023 6:56:21 PM PDT by Getready (Wisdom is more valuable than gold and harder to find.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: nickcarraway
Swedish mathematician Per Enflo, is no ambitious up-and-comer. He is almost 80, has made a name for himself solving open problems,

But the "bien pensants" believe that we are all useless eaters after age 75 and should be expendable past that age. Maybe these opinion leaders are simply wrong.


46 posted on 07/09/2023 8:18:10 PM PDT by magooey (The Mandate of Heaven resides in the hearts of men.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: GOPJ; 6SJ7; AdmSmith; AFPhys; Arkinsaw; allmost; aristotleman; autumnraine; bajabaja; ...
Thanks GOPJ. No one is crankier than a vexed theorist.


· List topics · post a topic · subscribe · Google ·

47 posted on 07/11/2023 9:04:38 AM PDT by SunkenCiv (Putin should skip ahead to where he kills himself in the bunker.)
[ Post Reply | Private Reply | To 15 | View Replies]

To: dfwgator

Lol!!!!!


48 posted on 07/11/2023 9:42:41 AM PDT by rdl6989 ( )
[ Post Reply | Private Reply | To 3 | View Replies]

To: SunkenCiv; nickcarraway

Cool, it indicates that it is never too late for us to study complicated problems.

In case there are updates they will be published here:
On the invariant subspace problem in Hilbert spaces by Per H. Enflo https://arxiv.org/abs/2305.15442

with a discussion of the paper https://mathoverflow.net/questions/447664/understanding-a-simplifying-assumption-in-invariant-subspace-problem-proof

and a non-technical paper by Mostafa Behtouei:
Invariant Subspace Problem in Hilbert Spaces: Exploring Applications in Quantum Mechanics, Control Theory, Operator Algebras, Functional Analysis and Accelerator Physics

In conclusion, the invariant subspace problem is a fundamental question in operator theory with applications in various branches of mathematics and physics. Its
study provides insights into the behavior of linear operators, quantum systems, and
operator algebras. While the problem remains unsolved in many cases, it continues to stimulate research and uncover new connections between different areas of
mathematics.

https://arxiv.org/pdf/2306.17023.pdf


49 posted on 07/11/2023 10:10:32 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 47 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-2021-4041-49 last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
General/Chat
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson