Free Republic
Browse · Search
General/Chat
Topics · Post Article

Skip to comments.

Team solves mystery associated with DNA repair
Biology News Net ^ | December 13, 2012 | NA

Posted on 12/14/2012 4:01:29 PM PST by neverdem

Every time a human or bacterial cell divides it first must copy its DNA. Specialized proteins unzip the intertwined DNA strands while others follow and build new strands, using the originals as templates. Whenever these proteins encounter a break – and there are many – they stop and retreat, allowing a new cast of molecular players to enter the scene.

Scientists have long sought to understand how one of these players, a repair protein known as RecA in bacterial cells, helps broken DNA find a way to bridge the gap. They knew that RecA guided a broken DNA strand to a matching sequence on an adjoining bit of double-stranded DNA, but they didn't know how. In a new study, researchers report they have identified how the RecA protein does its job.

"The puzzle for scientists has been: How does the damaged DNA look for and find its partner, the matching DNA, so that it can repair itself?" said University of Illinois physics professor Taekjip Ha, who led the study. "Because the genomic DNA is millions of bases long, this task is much like finding a needle in a haystack. We found the answer to how the cell does this so quickly."

The research is described in a paper in eLife, a new open-access journal supported by the Howard Hughes Medical Institute (HHMI), the Max Planck Society and the Wellcome Trust. Ha is an HHMI investigator. The National Science Foundation provided primary funding for this work.

DNA repair is vital to health, vitality and longevity. Disruptions of the process can lead to the early onset of diseases associated with aging or cancer in animals. The breast cancer mutation known as BRCA2, for example, disrupts a gene involved in loading Rad51 (the human equivalent of RecA) onto a broken DNA strand to begin the process of repair.

Previous studies have shown that in bacteria, RecA forms a filament that winds itself around a broken, single strand of DNA. Like a matchmaker trying to find a partner for an unpaired dancer, it scours the corresponding DNA strands for a sequence that will pair up perfectly with the broken strand. Once it finds the sequence, the broken strand steps in and chemically bonds to its new partner, displacing one of the unbroken strands (which eventually pairs with the other broken strand). This elaborate molecular square dance allows the cell to go back to the work of duplicating its genome. Each broken strand now is paired with an unbroken one, and uses the intact strand as a template for replication. (Watch an animation about this process.)

"If a break in DNA occurs, you have to repair it," Ha said. "We wanted to know how RecA helps the DNA find a sequence complementary to it in the sea of genomic DNA, and how it does it so quickly."

To answer this question, the researchers made use of fluorescence resonance energy transfer (FRET) to observe in real time the interaction of the RecA protein and the DNA. FRET uses fluorescent molecules whose signals vary in intensity depending on their proximity to one another. By labeling a single DNA strand bound by RecA and putting a different fluorescent label on a stretch of double-stranded DNA, the researchers could see how the molecules interacted with one another.

The team determined that RecA that is bound to a broken, single-stranded DNA molecule actually slides back and forth along the double-stranded DNA molecule searching for a match.

"We discovered that this RecA filament can slide on double-stranded DNA for a span of sequences covering about 200 base pairs of DNA," Ha said. "This is how one strand of DNA can be exchanged with another from a different DNA duplex. That's the process called 'recombination.' "

The discovery explains how DNA repair can occur so quickly, Ha said.

"We did a calculation that found that without this kind of process that we discovered, then DNA repair would be 200 times slower," he said. "So your DNA would not be repaired quickly and damage would accumulate, possibly leading to serious diseases."

The research team included graduate students Kaushik Ragunathan and Cheng Liu. Ha is an affiliate of the Institute for Genomic Biology and a co-director of the NSF Center for the Physics of Living Cells at Illinois.

Source : University of Illinois at Urbana-Champaign


TOPICS: Health/Medicine; Science
KEYWORDS: biochemistry; dna; dnarepair; godsgravesglyphs; helixmakemineadouble; reca
RecA filament sliding on DNA facilitates homology search

FReebie! RecA almost sounds like a sentient being.

1 posted on 12/14/2012 4:01:42 PM PST by neverdem
[ Post Reply | Private Reply | View Replies]

To: neverdem
Or very well designed.

/johnny

2 posted on 12/14/2012 4:12:19 PM PST by JRandomFreeper (Gone Galt)
[ Post Reply | Private Reply | To 1 | View Replies]

To: neverdem

A computer ~ a very tiny super computer


3 posted on 12/14/2012 4:22:11 PM PST by muawiyah
[ Post Reply | Private Reply | To 1 | View Replies]

To: neverdem

Not to rain on their parade but 99% of this stuff about RecA has been known for 40 years. My graduate advisor worked on this enzyme in the 60’s. Its one of the best understood DNA repair enyzymes and has been for decades.


4 posted on 12/14/2012 4:43:57 PM PST by Brooklyn Attitude (Obama being re-elected is the political equivalent of OJ being found not guilty.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Brooklyn Attitude
i doubt they understood the wrapping of a filament around a broken strand in the 60s, or the 70s, 80s, and maybe not the 90s ~ the idea is they KNEW WHAT IT DID, but not the details off HOW IT DID WHAT IT DID.

Next up, WHY DOES IT DO THAT

5 posted on 12/14/2012 5:02:47 PM PST by muawiyah
[ Post Reply | Private Reply | To 4 | View Replies]

To: muawiyah

“i doubt they understood the wrapping of a filament around a broken strand in the 60s, or the 70s, 80s, and maybe not the 90s ~ the idea is they KNEW WHAT IT DID, but not the details off HOW IT DID WHAT IT DID.”

Actually they knew about the protein complexing and wrapping around the strands in the early 80s. They certainly didnt know all the details but they had a pretty good idea of how it works.


6 posted on 12/14/2012 5:24:44 PM PST by Brooklyn Attitude (Obama being re-elected is the political equivalent of OJ being found not guilty.)
[ Post Reply | Private Reply | To 5 | View Replies]

Lightning struck “primordial soup” which caused living cells complete with self-replicating, self-repairing dna to happen. Nope, that doesn’t take any faith at all to believe. /s


7 posted on 12/14/2012 6:29:04 PM PST by Hayride
[ Post Reply | Private Reply | To 6 | View Replies]

To: Hayride

It takes much more “faith” to believe that this is not design.
I am perpetually amazed at how stupid I was when I was young, and smart, yet without wisdom.


8 posted on 12/14/2012 11:14:34 PM PST by ImaGraftedBranch (...By reading this, you've collapsed my wave function. Thanks.)
[ Post Reply | Private Reply | To 7 | View Replies]

To: neverdem
Interesting, this might as well explain why the repair mechanism sometimes does not work and lead to cancer. The bacterial RecA is homologous to the mammal Rad51-related protein family that participates in homologous recombination to maintain chromosome stability and repair DNA damage. It is highly conserved, and thus have a very high importance in most eukaryotes, from bacteria to humans.

http://en.wikipedia.org/wiki/RAD51

9 posted on 12/15/2012 1:29:34 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 1 | View Replies]

To: muawiyah

This is certainly fascinating research. I would love to be in a lab involved with doing it.


10 posted on 12/15/2012 6:39:00 AM PST by AFPhys ((Praying for our troops, our citizens, that the Bible and Freedom become basis of the US law again))
[ Post Reply | Private Reply | To 5 | View Replies]

To: martin_fierro; blam

 GGG managers are SunkenCiv, StayAt HomeMother & Ernest_at_the_Beach
Thanks neverdem.

Just adding to the catalog, not sending a general distribution.

To all -- please ping me to other topics which are appropriate for the GGG list.


11 posted on 12/15/2012 11:29:15 AM PST by SunkenCiv (https://secure.freerepublic.com/donate/)
[ Post Reply | Private Reply | View Replies]

To: JRandomFreeper
Or very well designed.

By a deist Designer using the laws of physics and evolutionary principles.

12 posted on 12/15/2012 11:35:03 AM PST by Moonman62 (The US has become a government with a country, rather than a country with a government.)
[ Post Reply | Private Reply | To 2 | View Replies]

To: Moonman62
By a deist Designer using the laws of physics and evolutionary principles.

I don't presume to tell the gardener how to do his job, much less tell the Creator of the Universe(s) how to do His.

However He did it, it's a Wonder.

And very elegant.

/johnny

13 posted on 12/15/2012 11:44:03 AM PST by JRandomFreeper (Gone Galt)
[ Post Reply | Private Reply | To 12 | View Replies]

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
General/Chat
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson