Free Republic
Browse · Search
General/Chat
Topics · Post Article

Skip to comments.

Ancient DNA Study Sheds New Light on History of Indo-European Languages
Sci dot News ^ | February 5, 2025 | News Staff

Posted on 02/08/2025 1:01:46 PM PST by SunkenCiv

Paleoanthropologists from the University of Vienna and Harvard University have analyzed ancient DNA from 435 individuals from Eurasian archaeological sites... They've discovered a previously unknown group, called Caucasus-Lower Volga (CLV) people, and found out that this population can be connected to all Indo-European-speaking populations.

Indo-European languages, which number over 400 and include major groups such as Germanic, Romance, Slavic, Indo-Iranian, and Celtic, are spoken by nearly half the world's population today...

These migrations out of the steppes had the largest effect on European human genomes of any demographic event in the last 5,000 years and are widely regarded as the probable vector for the spread of Indo-European languages.

The only branch of Indo-European language that had not exhibited any steppe ancestry previously was Anatolian, including Hittite, probably the oldest branch to split away, uniquely preserving linguistic archaisms that were lost in all other Indo-European branches.

Previous studies had not found steppe ancestry among the Hittites because, the new paper argues, the Anatolian languages were descended from a language spoken by a group that had not been adequately described before, a Chalcolithic population...

When the genetics of this newly-recognized Caucasus-Lower Volga population are used as a source, at least five individuals in Anatolia dated before or during the Hittite era show Caucasus-Lower Volga ancestry.

The new study shows the Yamnaya population to have derived about 80% of its ancestry from the Caucasus-Lower Volga group, which also provided at least one-tenth of the ancestry of Bronze Age central Anatolians, speakers of Hittite.

(Excerpt) Read more at sci.news ...


TOPICS: History; Science; Travel
KEYWORDS: anatolia; ancientautopsies; bronzeage; caucasuslowervolga; chalcolithic; clv; epigraphyandlanguage; genealogy; godsgravesglyphs; helixmakemineadouble; hittite; indoeuropean; maikop; yamnaya
Navigation: use the links below to view more comments.
first previous 1-2021-30 last
To: Varda; bricklayer

FREEBIES!!!

https://www.biorxiv.org/content/10.1101/2024.04.17.589597v1.full.pdf


21 posted on 02/08/2025 5:36:30 PM PST by SunkenCiv (Putin should skip ahead to where he kills himself in the bunker.)
[ Post Reply | Private Reply | To 5 | View Replies]

To: Varda; bricklayer

Pre-print version:

https://pmc.ncbi.nlm.nih.gov/articles/PMC11042377/


22 posted on 02/08/2025 5:37:45 PM PST by SunkenCiv (Putin should skip ahead to where he kills himself in the bunker.)
[ Post Reply | Private Reply | To 5 | View Replies]

Ooh, interesting tidbit that turned up:

Ancient DNA Reveals Asian Ancestry Introduced to East Africa in Early Modern Times
Findings clarify and complicate understanding of Swahili history
By Stephanie Dutchen
March 29, 2023
Research
6 min read
https://hms.harvard.edu/news/ancient-dna-reveals-asian-ancestry-introduced-east-africa-early-modern-times


23 posted on 02/08/2025 5:39:04 PM PST by SunkenCiv (Putin should skip ahead to where he kills himself in the bunker.)
[ Post Reply | Private Reply | View Replies]

To: SunkenCiv

Nice, thanks!


24 posted on 02/08/2025 5:42:48 PM PST by Varda
[ Post Reply | Private Reply | To 22 | View Replies]

To: chajin


"Caucasus-Lower Volga"


Should that be mentioned in front of kids?!
25 posted on 02/08/2025 6:01:13 PM PST by Bikkuri (I am proud to be a PureBlood.)
[ Post Reply | Private Reply | To 3 | View Replies]

To: SunkenCiv; PIF; marcusmaximus
and a nice map


26 posted on 02/09/2025 3:42:25 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 22 | View Replies]

To: SunkenCiv

Thanks!


27 posted on 02/09/2025 5:20:10 AM PST by bricklayer
[ Post Reply | Private Reply | To 1 | View Replies]

To: SunkenCiv

Sigh....no ydna haplogroup T.


28 posted on 02/09/2025 5:39:24 AM PST by bricklayer
[ Post Reply | Private Reply | To 23 | View Replies]

To: bricklayer

My pleasure.


29 posted on 02/09/2025 5:44:55 AM PST by SunkenCiv (Putin should skip ahead to where he kills himself in the bunker.)
[ Post Reply | Private Reply | To 27 | View Replies]

To: SunkenCiv
the Anatolian languages were descended from a language spoken by a group that had not been adequately described before, a Chalcolithic population...

How did that happen? I'd chalk it up their mixing with the Calque People.

Good luck explaining to the experts, though --

Etymology

From New Latin, from Ancient Greek χαλκός (khalkós, “copper”). Despite the appearance in English of a possible relation of chalco- to chalk, and any plausible semantic and cognate connections between limestones and ores in ancient times, the terms are not related by any known cognation. Note also the hard ch sound (/k/) in chalco- and words generated therefrom, which differs from the soft ch sound in chalk.

https://en.wiktionary.org/wiki/chalco-#English


30 posted on 02/09/2025 6:03:49 AM PST by Ezekiel (🆘️ "Come fly with US". 🔴 Ingenuity -- because the Son of David begins with MARS ♂️, aka every man)
[ Post Reply | Private Reply | To 1 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-2021-30 last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
General/Chat
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson