Free Republic
Browse · Search
General/Chat
Topics · Post Article

Skip to comments.

Iranian Regime tv Channel One hacked while it was airing Khamenie speech
various | 10-8-22

Posted on 10/08/2022 1:05:38 PM PDT by nuconvert

Iranian Regime national tv Channel One hacked about an hour ago. During a broadcast of Khamenie speech, a red crosshair appeared over his face and chanting of Women. Life. Freedom. There was writing to the side saying "Rise up. Join us". Also 4 photos at the bottom of the screen of young people killed and additional writing: "The blood of our youth is dropping from your paws".

Also, there was a huge banner in the middle of Tehran highway today that read: We are no longer afraid of you. We will fight.

Also, attempted attack on IRI ambassador in Denmark. Her bodyguard was stabbed. Diplomatic Security intervened before the attacker could stab the ambassador.


TOPICS:
KEYWORDS: basij; deathtothemullahs; denmark; ebrahimrigi; erdogan; iran; iranprotests; iraq; irgc; iri; israel; khameini; khamenei; kurdistan; lebanon; mahsaamini; mullahloversonfr; mullahsmustbekilled; najisharifizindashti; protests; qudsforce; raisi; receptayyiperdogan; shahrammaroufmola; syria; turkey; yemen; zahedi
Navigation: use the links below to view more comments.
first previous 1-20 ... 581-600601-620621-640 ... 1,541-1,546 next last
Iran Update, December 17, 2023

The Houthi anti-shipping attack campaign continues to achieve one of its desired effects of disrupting maritime traffic headed to Israel. Hong Kong-based shipping company Orient Overseas Container Line (OOCL) announced on December 17 that it would immediately stop shipping goods to and from Israel.[77] The company cited “operational issues” for the policy.[78] OOCL is the first global shipping company that CTP-ISW has observed to specifically halt operations to Israel since the Houthis began their campaign against international shipping around the Bab al Mandeb in November.[79] Global shipping giants, such as Mediterranean Shipping Company, CMA CGM, Maersk, and Hapag-Lloyd, previously announced that they would pause operations around the Red Sea but did not specify how it would affect their services to Israel.[80] Houthi spokesperson Mohammed Abdulsalam commended OOCL’s decision to stop sending ships to Israeli ports and falsely asserted that the Houthis are only attacking ships linked to Israel on December 17.[81] Several of the ships that the Houthis have attacked in recent days were en route to destinations outside of Israel, such as Saudi Arabia.
full report: https://www.understandingwar.org/backgrounder/iran-update-december-17-2023

The Iranian connection is well known. This is from 2021:

Iran has provided the Houthis with weapons and technology for anti-tank guided missiles; sea mines; UAVs, such as the Qasef family; 122-millimeter Katyusha rockets; Misagh-2 man-portable air defense systems (MANPADS); RDX high explosives; ballistic and cruise missiles; and UMVs. One specific example is the Houthi use of Borkan-2H mobile, short-range ballistic missiles, which they have used to strike Riyadh and other targets in Saudi Arabia. A UN panel of experts concluded that the missiles were “a derived lighter version” of Iran's Qiam-1 missile and that Iran provided key missile parts to the Houthis. Iranian components were also integrated into Yemeni SA-2 surface-to-air missiles to construct the Qaher series of surface-to-surface missiles. The Houthis have also developed a modified version of the Iranian Quds-1 and Quds-2 cruise missiles, with Iranian assistance.

https://www.csis.org/analysis/iranian-and-houthi-war-against-saudi-arabia

601 posted on 12/18/2023 12:31:57 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 600 | View Replies]

Iran Update, December 18, 2023

The Houthis claimed to have conducted two drone attacks targeting the Norwegian-owned, Cayman Islands-flagged Swan Atlantic tanker and Swiss-owned, Panama-flagged MSC Clara container ship in the Red Sea on December 18.[69] The Houthi Navy initially deployed unspecified “craft” with armed personnel to direct the ships to alter course before attacking them.[70] The Houthi military spokesperson claimed that the group conducted drone attacks on the two ships.[71] US officials stated, on the other hand, that multiple unspecified “projectiles” had been launched from Houthi-controlled territory in Yemen.[72] It is unclear what munitions the Houthis used to conduct the attacks at the time of writing. The USS Carney responded to the Atlantic's distress call.[73] Western media reported that the Atlantic was damaged in the attack.[74] The UK Maritime Trade Operations reported an explosion in the water near a vessel south of the port of Mokha in Yemen.[75] The Houthis have expanded their attacks on maritime traffic around the Red Sea to include all vessels traveling to Israel after having threatened to do so on December 9 and 12.[76]

The Houthi anti-shipping attack campaign continues to achieve one of its desired effects of disrupting Red Sea maritime traffic headed to Israel. The British petroleum company BP, Taiwanese shipping company Evergreen Line, and Belgian oil tanker company Euronav announced on December 18 that they will suspend shipping operations in the Red Sea.[77] Norwegian energy group Equinor similarly stated that it had rerouted an unspecified number of ships away from the Red Sea.[78] The above companies cited the “deteriorating security situation” in the area and concern for the “safety of ships and crew.” The Hong Kong-based shipping company Orient Overseas Container Line (OOCL) similarly announced on December 17 that it would immediately stop shipping goods to and from Israel.[79] Global shipping giants, such as Mediterranean Shipping Company, CMA CGM, Maersk, and Hapag-Lloyd, previously announced that they would pause operations around the Red Sea but did not specify how it would affect their services to Israel.[80]

The Jordanian armed forces clashed with Iran-backed militias attempting to smuggle weapons and drugs through the Jordan-Syria border on December 18. [86] Jordanian state media stated that this was the largest armed cross-border weapons and drug smuggling operation in recent years.[87] Several Jordanian army personnel and smugglers were injured or killed during the clash. The Jordanian army similarly announced that it had neutralized an unspecified number of drug smugglers attempting to smuggle Captagon into the country on December 12.[88] The Syrian regime and Iran-backed militias mass produce the drug in Syria and smuggle it through Jordan to the Gulf Arab states, generating billions of dollars of revenue for the malign actors.[89] Jordanian and Western officials have stated that Iran and LH have been behind the surge in drug and weapons smuggling from southern Syria into Jordan.[90] The Jordanian armed forces conducted air strikes on Iran-linked drug factories in southern Syria in May 2023.[91]

Jordanian officials have been concerned about Iranian threats to their security beyond drug and weapons smuggling.
[92] The Jordanian Armed Forces shot down three drones that traveled into their airspace from Syria in August 2023, which Jordanian officials linked to Iran-backed militias in Syria.[93] Jordan also borders Iraq and the West Bank whose local governments and security institutions are infiltrated by Iran-backed militias that can then infiltrate Jordan from all directions. Some Western analysts have noted that Jordan is home to millions of displaced refugees from Iraq, Syria, and the West Bank which Iran can recruit for its militant groups.[94] Many of the Palestinian civil society organizations in Jordan are reportedly linked to Iran-sponsored groups.[95]

full report: https://www.understandingwar.org/backgrounder/iran-update-december-18-2023

602 posted on 12/20/2023 4:23:56 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 601 | View Replies]

To: AdmSmith
Iran Update, December 19, 2023

The Jordanian Air Force conducted airstrikes on Iran-linked drug smuggling targets in Salkhad, Suwayda Province, Syria, on December 18.[80] The targets facilitated drug smuggling from Syria into Jordan and the Gulf states. The airstrikes follow small arms clashes between the Jordanian forces and Iran-linked individuals trying to smuggle drugs and weapons through the Jordan-Syria border between December 12 and 18.[81] The weapons included rocket launchers, anti-personnel mines, and other explosives. Jordan previously conducted airstrikes in Suwayda targeting Iran and LH-linked targets tied to drug smuggling in May 2023.[82]

Jordanian officials have previously expressed concern about Iran-linked security threats beyond drug and weapons smuggling.[83] The Jordanian armed forces shot down three drones that entered Jordan from Syria in August 2023.[84] Jordanian officials linked the drones to Iran-backed militias in Syria. Iranian-backed militias in Syria often use these drones to fly drugs over the border, but the drones could also be used to conduct attacks on civilian and military targets inside Jordan, including US forces stationed inside the country.[85] Iran-backed groups have also used Jordanian territory to smuggle weapons into Israel and the West Bank.[86]

full report: https://www.understandingwar.org/backgrounder/iran-update-december-19-2023

603 posted on 12/20/2023 4:25:59 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 602 | View Replies]

Iran Update, December 20, 2023

Iranian military leaders view current Hamas operations in the Gaza Strip as the prelude to a long-term war to destroy Israel. IRGC Commander Major General Hossein Salami stated the Palestinian resistance is practicing and gaining the necessary experience in “the formula for destroying Israel” during a meeting of provincial IRGC commanders in Khuzestan Province.[64] Iranian Defense and Armed Forces Logistics Minister Brigadier General Mohammad Reza Gharaei Ashtiani said on November 18 that Israel's military and intelligence failures since October 7 provide lessons for future action against it.[65] IRGC commanders previously framed Hamas’ al Aqsa Flood operation as a prelude to future attacks on Israel. Former IRGC Commander Major General Mohammad Ali Jafari framed the attack as a “warmup” to prepare and train for future operations against Israel in an interview on October 15.[66] Salami described Hamas’ operation as the “first stage” of Israel's “hasty collapse” on the same day.[67] Salami previously outlined what he considered to be the formula for destroying Israel during an interview with the Supreme Leader's website in August 2022. Salami argued that Lebanese Hezbollah and Palestinian militias needed to conduct more ground operations and urban combat inside Israel that would destabilize and generate internal displacement leading to Israel's collapse.[68]

full report https://www.understandingwar.org/backgrounder/iran-update-december-20-2023

604 posted on 12/20/2023 11:57:32 PM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 603 | View Replies]

Iran Update, December 21, 2023

Iranian Law Enforcement Commander Brigadier General Ahmad Reza Radan visited Rask, Sistan and Baluchistan Province, on December 21 following recent anti-regime militant attacks in the province.[75] The Balochi Salafi-Jihadist group Jaish al Adl conducted a two-stage attack on a police station in Rask on December 15, killing 11 Law Enforcement Command (LEC) officers.[76] Likely Jaish al Adl fighters also conducted an improvised explosive device attack targeting an IRGC Special Forces Brigade near Zahedan, Sistan and Baluchistan Province, on December 19.[77] Radan visited the police station that was attacked and thanked Sunni and Shia police officers for uniting to “defend the homeland.” Radan warned that Iran will take severe revenge against terrorists and claimed that Iran reserves the right to pursue terrorists “anywhere.” Radan additionally conducted an aerial visit of Iran’s southeastern borders and called on the Pakistani government to increase its border security efforts. Iranian military officials have previously pressured the Pakistani government to crack down on Jaish al Adl “safe havens and cells” in Pakistan.[78]
https://www.understandingwar.org/backgrounder/iran-update-december-21-2023
full report


605 posted on 12/23/2023 12:59:23 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 604 | View Replies]

To: AdmSmith
Iran Update, December 22, 2023

The Wall Street Journal reported on December 22 that an Iranian spy ship is directing Houthi attacks on commercial vessels in the Red Sea.[75] This spy ship is likely the Behshad, which is an Iranian Islamic Revolutionary Guards Corp intelligence gathering ship operating off the Dahlak archipelago in the Red Sea.[76] The Journal reported that the Iranian spy ship provides the Houthis with real-time intelligence, which enables them to target ships that have gone silent to avoid detection. This reporting is consistent with previous Western media reporting and statements from US officials that the IRGC is involved in planning and executing the Houthis’ drone and missile attacks on ships in the Red Sea.[77] The IRGC Quds Force might have used the Behshad, or its predecessor the Saviz, to provide explosive-laden drone boats to the Houthis in recent years.[78] The Saviz might have similarly been supporting Houthi attacks on commercial tankers in the Bab al Mandab Strait and facilitating the smuggling of personnel and materials into Yemen via small dhows prior to the Israeli limpet mine attack on the Saviz in April 2021. [79]

Full report
https://www.understandingwar.org/backgrounder/iran-update-december-22-2023

US intelligence informed its allies in the Gulf that last week that Iran sent three commercial ships to the Red Sea. The first is a cargo carrier converted to carry out reconnaissance missions, the second is a support ship, and the third is a container ship. According to sources, these three ships carry out the mission of logistical support for the Houthis and provide them with the intelligence information they need about Israeli or American targets in the Red Sea.

This means there are four Iranian ships in the Red Sea, including the “Behshad” ship, which is used as a spy base and has been operating since 2021 off the Eritrean Dahlak Archipelago. It arrived there as a replacement for the Saviz, a ship that was used as a spy base and was damaged in an attack attributed to Israel.

The sources said that since the Houthis kidnapped the Galaxy Leader cargo ship on November 19, the Mossad and Shin Bet have raised questions with regional intelligence services about the role of Behshad in supporting the Houthis logistically and how the Houthis obtained intelligence information about the ownership of the targeted ship and selected it among dozens of cargo ships that pass off Yemen daily.

According to Sheba Intelligence sources, the Israelis shared information with Gulf security services, including their confirmation that Galaxy Leader had stopped its navigation indicators several hours before the Houthi attack and passed next to Behshad, which has advanced navigation devices. This same thing happened when the Houthis attacked on Sunday on three ships crossing the Bab al-Mandab Strait. Though the navigation indicators of the ships were closed, the vessels received direct warning messages from the Houthis and were then attacked.

The source calculated that Iran's sending of the three ships to provide logistical support to the Houthis in the Red Sea came at the request of the group's representatives during a meeting last month with Iranian officials and leaders of the Revolutionary Guard in Tehran.

https://shebaintelligence.uk/intelligence-war-in-the-red-sea

606 posted on 12/23/2023 2:14:15 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 605 | View Replies]

Iran Update, December 23, 2023

Iran and its so-called “Axis of Resistance” are signaling their capability and willingness to attack maritime targets beyond just the Persian Gulf and Red Sea. A one-way drone struck a commercial vessel off the coast of India, causing structural damage to the ship, on December 23.[1] The vessel is partially Israeli-owned.[2] Israeli media reported that Iran was responsible for the attack, which is consistent with the ongoing anti-shipping campaign that Iran and the Houthi movement have conducted around the Bab al Mandeb in recent weeks.[3] This attack follows the Islamic Resistance of Iraq—a coalition of Iranian-backed Iraqi militias—claiming on December 22 that it conducted an unspecified attack on a “vital target” in the Mediterranean Sea.[4] There is no evidence that the Islamic Resistance of Iraq conducted an attack into the Mediterranean Sea at the time of writing. The claim, nevertheless, signals the readiness of the Iraqi group to participate in the Iran-led attack campaign on maritime targets. Finally, a senior commander in Iran's Islamic Revolutionary Guards Corps (IRGC), Brigadier General Mohammad Reza Naghdi, threatened to expand the anti-shipping campaign to the Mediterranean Sea and Strait of Gibraltar on December 23.[5] Naghdi frequently makes inflammatory threats toward Iranian adversaries, but his statement is particularly noteworthy given the drone attack off the Indian coast and the claimed attack by the Islamic Resistance of Iraq. Iran and its Axis of Resistance are likely messaging their capability and willingness to widen geographically their anti-shipping attack campaign in response to the United States forming a multinational naval task force to safeguard commercial traffic around the Red Sea.

Iran has invested in building “drone carriers” to add to its naval forces in recent years, which will amplify the threat that the Axis of resistance poses to international shipping and other maritime targets. Iran has built several forward base ships and other offensive vessels, sometimes constructed from converted commercial tankers, to conduct expeditionary and out-of-area operations since 2021.[6] These Iranian vessels can carry drones as well as other platforms, such as fast attack craft, helicopters, and missiles, which facilitates Iranian force projection. These Iranian ships would not likely survive conventional engagements with the United States. They can, however, support attacks on commercial traffic similar to the recent Houthi attacks around the Bab al Mandeb.

Iranian assistance to the Russian invasion of Ukraine will compound further the threat that Iranian drones pose. The war has incentivized Iran and Russia to expand their capacities to manufacture Iranian-designed, one-way attack drones. CTP-ISW previously reported on how Iran is helping to establish drone manufacturing facilities in Russia and Belarus.[7] These facilities will, in theory, allow Russian forces to more rapidly field Iranian-designed drones in Ukraine. The use of Iranian drones in Ukraine is furthermore providing Moscow and Tehran opportunities to test these platforms in a modern combat zone and learn lessons on how to use such platforms more effectively.

full report https://www.understandingwar.org/backgrounder/iran-update-december-23-2023

607 posted on 12/24/2023 1:29:39 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 606 | View Replies]

To: AdmSmith

Iran Update, December 24, 2023

Iranian Foreign Affairs Ministry Senior Advisor Ali Asghar Khaji discussed the Israel-Hamas war in a meeting with Russian Foreign Ministry Special Representative for the Middle East Peace Process Vladimir Safronkov in Tehran on December 24.[51] Khaji and Safronkov discussed “political ways” to end the Israeli ground operation in the Gaza Strip, implement an immediate ceasefire, and provide humanitarian aid to Gazans.

full report https://www.understandingwar.org/backgrounder/iran-update-december-24-2023


608 posted on 12/25/2023 1:19:18 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 607 | View Replies]

To: AdmSmith
Iran summoned Russia's charge d’affaires after Moscow and Arab countries released a joint statement earlier this week challenging Iran's claim to disputed islands in the Persian Gulf,

Iran's official IRNA news agency said the Russian envoy was summoned on Saturday and handed a note to deliver to Moscow in which Tehran protested the statement the 6th Arab-Russian Cooperation Forum issued in Morocco that called for a peaceful solution to resolve the conflict between Iran and the United Arab Emirates over the islands.

This marked the second time this year that Iran has called for a Russian envoy in protest over comments on the disputed islands. Tehran summoned the Russian ambassador in July over a similar statement.

The diplomatic spat is a rare occurrence between the two countries that have deepened their ties since Moscow invaded Ukraine, with Iran supplying Russia with killer drones that have been used to devastating effect there. Both countries have also been strong backers of President Bashar Assad in Syria's civil war. In 2022, Iran summoned China's envoy over a similar joint statement with Arab nations.

Iran took control of the three islands of Abu Musa, the Greater Tunb and the Lesser Tunb after British forces withdrew in 1971. It considers them an “inseparable” part of its territory. The UAE also claims the three islands and has long pressed for a negotiated solution.

>

https://www.voanews.com/a/iran-summons-russian-envoy-over-statement-on-persian-gulf-disputed-islands-/7410524.html

609 posted on 12/25/2023 2:37:09 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 608 | View Replies]

To: SeekAndFind

Iran Threatens to Close the Mediterranean Sea to Commerce if the US Continues to Support Israel’s War to Root Out Terrorists in Gaza.
https://freerepublic.com/focus/f-bloggers/4205679/posts


610 posted on 12/25/2023 5:33:45 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 609 | View Replies]

U.S. CENTCOM conducts strikes against Kataib Hezbollah terrorist group targets in Iraq

In response to multiple attacks against coalition forces in Iraq and Syria, U.S. military forces conducted airstrikes against multiple facilities used by Kataib Hezbollah and affiliated groups in Iraq at 8:45 p.m. (EST) on Dec. 25. Earlier in the day, Iranian sponsored Kataib Hezbollah terrorists and affiliated groups attacked coalition forces at Erbil, Iraq resulting in several injuries.

Early assessments indicate that these U.S. airstrikes destroyed the targeted facilities and likely killed a number of Kataib Hezbollah militants. There are no indications that any civilian lives were affected. The U.S. military will continue to evaluate the effectiveness of these strikes. “These strikes are intended to hold accountable those elements directly responsible for attacks on coalition forces in Iraq and Syria and degrade their ability to continue attacks. We will always protect our forces,” said General Michael Erik Kurilla, U.S. Central Command Commander.

https://twitter.com/CENTCOM/status/1739470809155227809


611 posted on 12/25/2023 11:07:08 PM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 610 | View Replies]

Iran Update, December 26, 2023

Iranian Supreme National Defense University (SNDU) President IRGC Brigadier General Esmail Ahmadi Moghaddam discussed security and counterterrorism cooperation with Iraqi Popular Mobilization Forces (PMF) Chairman Faleh al Fayyadh in Baghdad on December 26.[82] Moghaddam and Fayyadh discussed “exchanging experiences and information” between the SNDU and PMF. The meeting between Moghaddam and Fayyadh may have been part of ongoing Iranian efforts to professionalize and institutionalize the PMF. Doing so would consolidate Iranian influence in the Iraqi security sector since the IRGC strongly influences various militias under the PMF. Moghaddam previously served as Iran's police chief between 2005 and 2015.[83] He was instrumental in the Iranian regime's crackdown on the 2009 Green Movement and was sanctioned by the United States in 2011 for committing human rights abuses.[84] Moghaddam also met with Iraqi National Defense University President Lieutenant General Aqeel Mustafa Mahdi, Iraqi Federal Police head Major General Saleh Naser al Ameri, Iraqi National Security Advisor Qasem al Araji, and Iraqi Interior Minister Abdul al Shammari during his visit to Baghdad between December 24 and 26.[85] Moghaddam may have discussed internal security and his experience suppressing civil unrest during his conversations with Iraqi officials.

The Russia-led Eurasian Economic Union (EaEU) signed a free trade agreement with Iran on December 25.[120] The agreement will eliminate customs duties on almost 90 percent of goods and establish a preferential regime for most of the trade between Russia and Iran. This agreement serves to replace a similar temporary agreement that has been in force since 2019.[121]

full report https://www.understandingwar.org/backgrounder/iran-update-december-26-2023

612 posted on 12/26/2023 11:40:13 PM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 608 | View Replies]

To: Red Badger

U.S. shoots down 12 suicide drones, three anti-ship ballistic missiles and two land attack cruise missiles fired by Iran-backed rebels in southern Red Sea over 10-hour period

https://freerepublic.com/focus/f-news/4206104/posts


613 posted on 12/27/2023 11:22:48 PM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 612 | View Replies]

Iran Update, December 27, 2023

Central Bank of Iran Governor Mohammad Farzin traveled to Moscow on December 26 to discuss banking and finalize trade agreements with Russian officials.[98] IRIB reported that the bank managers of the Bank of Russia and the National Bank of Iran established a credit line worth 6.5 billion rubles (approx. $70 million) to allow Iran to import basic goods from Russia. Iran and Russia finalized an agreement to conduct trade using their national currencies —rather than the US dollar— on December 27.[99] Iranian media said that this agreement allows previously established non-SWIFT messaging systems and bilateral brokerage relations to now be used by banks and economic operators.[100]

full report:_ https://www.understandingwar.org/backgrounder/iran-update-december-27-2023


614 posted on 12/27/2023 11:27:49 PM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 613 | View Replies]

Iran Update, December 28, 2023

Iraqi Prime Minister Mohammed Shia al Sudani announced that his administration will begin procedures to remove International Coalition forces from Iraq during a press conference on December 28, likely due to pressure from Iranian-backed Iraqi militias. These militias have used legal, military, and political pressure in recent weeks to expel US forces, as CTP-ISW previously assessed. This pressure, particularly the Iranian-backed attacks on US forces, creates an escalation cycle that triggers US self-defense strikes to protect US servicemembers. The Iranian-backed factions and militias then misrepresent these self-defense strikes as violations of Iraqi sovereignty, which generates domestic pressure on Sudani to remove US forces. This pressure appears to have succeeded at least partly in that Sudani repeated Iranian-backed militia talking points about the United States. Sudani said that that the self-defense strikes are violations of Iraqi sovereignty and were inconsistent with the advisory role of the International Coalition.[1] These claims ignore the fact that the US forces have a right to self-defense and that the Iranian use of client militias and proxies in Iraq to attack US forces in line with Tehran’s regional agenda is itself a violation of Iraqi sovereignty. US advisory forces are currently deployed in Iraq for counter-ISIS operations at the invitation of the Iraqi [2]government. Sudani did not provide a timeline for removing International Coalition forces or describe the mechanism by which they would be removed.[3]

An Iraqi decision to expel US forces will very likely create space for ISIS to rapidly resurge in Syria within 12 to 24 months and then threaten Iraq. The US military mission in these countries is to enable the enduring defeat of ISIS and through cooperation with local partners.[4] The US support to its counter-ISIS partners in both Iraq and Syria is instrumental to successfully defeating ISIS.[5] US forces and infrastructure in Iraq provide the logistical support that enables the presence of US forces in Syria. The expulsion of US forces from Iraq would necessitate a withdrawal from Syria, where ISIS is reconstituting itself in Syrian regime-held territory.[6] CTP-ISW continues to assess that the United States and its partner in Syria have successfully contained but not defeated ISIS and that the US withdrawal from Syria will very likely cause a rapid resurgence in Syria within 12 to 24 months.[7] A resurgent ISIS would then be able to threaten Iraq again. The Iraqi Security Forces still face significant deficiencies in logistics, intelligence, and fire support that inhibit their ability to defeat ISIS alone.[8]

full report: https://www.understandingwar.org/backgrounder/iran-update-december-28-2023

615 posted on 12/29/2023 12:00:44 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 614 | View Replies]

This is an extremely pertinent comment by @general_ben. Deterrence requires the application of force when challenged. Targeting Houthi Points of Origin is essential. The old “it fires, it dies” logic. Our Enemies are watching.

4 min video
https://twitter.com/Felix_Nuno/status/1740082935569535115

616 posted on 12/29/2023 12:02:41 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 615 | View Replies]

Iran Update, December 29, 2023

Iran has increased its production rate of highly enriched uranium (HEU). The United States and the E3 (France, Germany, Italy) confirmed in a joint statement on December 28 that Iran has increased its enrichment rate of 60 percent purity uranium.[1] Iran has been stockpiling 60 percent HEU since April 2021.[2] Iran decreased its enrichment rate and HEU stockpile after it reached an informal nuclear agreement with the United States in August 2023.[3] Western media reported that the United States refroze Iranian financial assets released as part of the agreement in October.[4] Iran's current stockpile of 60 percent HEU stands at 128.3 kilograms as of October 28.[5]

This development is consistent with CTP-ISW’s long-standing assessment that Iran has developed a nuclear program that it intends to use to produce a nuclear arsenal.[6] The International Atomic Energy Agency (IAEA) defines 25 kilograms of 20 percent or more enriched HEU as a “significant quantity” for “which the possibility of manufacturing a nuclear explosive device cannot be excluded.”[7] Iran has stockpiled at least five bombs worth of HEU, given Iran's current stockpile of 128.3 kilograms of 60 percent HEU. Iran previously planned to serially produce nuclear warheads for ballistic and cruise missiles as part of its pre-2003 nuclear weapons program[8] The stockpiling of HEU is one of the key steps Iran would have to pursue to develop an arsenal and has previously conducted work on the other key steps in weaponization and delivery vehicles.[9] The Iranian enrichment infrastructure is also designed for a speedy mass production of HEU and/or weapons-grade uranium for multiple nuclear weapons.[10]

Iran has no use for 60 percent HEU other than for use in a compact nuclear explosive or to further enrich it to 90 percent weapons-grade uranium. Sixty percent HEU can only be used for nuclear weapons and does not have an alternate civilian purpose. The required enriched uranium purity for energy purposes [in a ligtht water reactor, as Iran has (mý correction)] is between 3 to 5 percent, and medical research reactors use 20 percent HEU.[11] Iran is now capable of producing weapons-grade uranium at a much faster rate than it would be if it only had a stockpile of lower than 60 percent enriched uranium.

The US Treasury Department sanctioned a Turkish and Yemeni financial network that enabled the IRGC Quds Force to fund the Houthis.[77] The US sanctions targeted one Yemeni, one Turkish entity, two Yemeni entities, and one Turkish entity responsible for facilitating financial flows between the IRGC Quds Forces and the Houthi movement. The Treasury Department said that Iranian funding enables Houthi attacks against international shipping in the Red Sea. The sanctions targeted Turkey-based Al Aman Kargo Ithalat Ihracat Ve Nakliyat Limited Sirketi (Al Aman), which Treasury said served as ”a waypoint for money sent by” Iran to Houthi businesses in Yemen. The sanctions also targeted two Yemeni money exchanges tied to the Houthis and one Yemeni national, the president of the Yemeni Currency Exchangers Association in Houthi-controlled Sanaa, Yemen.[78]

full report: https://www.understandingwar.org/backgrounder/iran-update-december-29-2023

617 posted on 12/30/2023 1:03:46 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 615 | View Replies]

Iran Update, December 30, 2023

The Houthi military spokesperson warned the United States against “escalating” with the Houthis and rallying other nations to protect Israeli shipping on December 29. Brigadier General Yahya Sarea emphasized the Houthis’ defensive readiness and commitment to the Palestinian cause, which is consistent with prior Houthi rhetoric.[108] The Houthis have conducted an anti-shipping attack campaign around the Red Sea in recent weeks to disrupt commercial shipping to Israel and demonstrate both the willingness and capability of the Axis of Resistance to disrupt maritime traffic around strategic maritime chokepoints.[109] The United States announced Operation Prosperity Guardian on December 18 to counter Houthi attacks on international shipping.[110]

full report: https://www.understandingwar.org/backgrounder/iran-update-december-30-2023


618 posted on 12/31/2023 1:08:00 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 617 | View Replies]

Iran Update, December 31, 2023

Houthi fighters conducted two attacks on the MV Maersk Hangzhou container ship in the southern Red Sea. Likely Houthi fighters conducted a missile attack on the ship on December 30.[68] The USS Gravely destroyer intercepted two anti-ship missiles targeting the Hangzhou, while responding to a distress call from the ship.[69] Four Houthi fast attack craft later approached the Hangzhou, firing on the container ship and attempting to board it.[70] The USS Gravely and USS Eisenhower aircraft carriers sent helicopters to the container ship and issued verbal messages to the Houthi boats, which then fired on the helicopters.[71] The helicopters returned fire in self-defense and sank three of the four Houthi boats, killing ten Houthi members.[72] The fourth Houthi boat fled the area.

Houthi military spokesperson Yahya Saree said that Houthi fighters had been performing their regular duties to provide security and stability in the Red Sea by preventing Israeli ships or ships en route to Israel from passing.[73] Saree accused the United States of attempting to expand the conflict into the Red Sea and warned other countries of being complicit to US efforts.[74] Saree’s statement notably quoted a Quranic verse that LH and the Islamic Resistance of Iraq regularly cite as justification for their attacks on the United States or Israel. The use of the passage across the Axis of Resistance members is likely meant to signal their unity to external actors, while framing their regional escalation as some kind of religious duty.

The Houthis likely focused on attacking a Maersk-operated vessel in particular because Maersk announced that it would resume its operations in the Red Sea on December 24.[75] CTP-ISW previously assessed that the Iranian and Houthi anti-shipping attack campaign is meant to demonstrate the capability and willingness of the Axis of Resistance to threaten multiple strategic maritime chokepoints across the Middle East. The Houthi framing that the anti-shipping attack campaign is meant to only prevent commercial traffic to Israel is inaccurate, as the Houthi attacks have targeted multiple ships with no immediate connection to Israel or Israeli interests. Maersk announced that it would again suspend its operations in the Red Sea—this time for 48 hours—on December 31.[76]

These Houthi attacks are part of a broader regional escalation that Iran is leading against the United States and Israel. This regional escalation is meant to achieve Iran's broader regional ambitions rather than achieve any discrete effects vis-a-vis the Israeli military operation in the Gaza Strip. This Iran-led escalation includes the almost daily drone, missile, and rocket attacks that Iranian-backed militias have conducted against US forces in Iraq and Syria. Iran and its proxies and partners in the Axis of Resistance are framing falsely this escalation as a response to the Israeli military operations in the Gaza Strip. Iran and its Axis of Resistance have a long history of threatening American servicemembers and international shipping prior to the war because it supports their grand strategic objectives in the Middle East. The current escalation is thus meant to help Iran attain regional hegemony, destroy the Israeli state, and expel US forces from the Middle East. The Israel-Hamas war provides informational cover to Iran and the Axis of Resistance, allowing them to misrepresent their long-standing campaigns as meant to support the Palestinian cause.

Iranian Foreign Affairs Minister Hossein Amir Abdollahian discussed recent Houthi attacks on international shipping in the Red Sea during a phone call with his British counterpart, David Cameron, on December 31.[77] Abdollahian suggested that Houthi attacks on maritime traffic would continue so long as Israel continues its military operations in the Gaza Strip. Cameron stated that Iran bears responsibility for the Houthi attacks given its long-standing support for the Houthis. The Houthis have conducted an anti-shipping attack campaign around the Red Sea in recent weeks to disrupt commercial shipping to Israel and demonstrate both the willingness and capability of the Axis of Resistance to disrupt maritime traffic around strategic maritime chokepoints.[78]

Supreme National Security Council Secretary Rear Admiral Ali Akbar Ahmadian discussed the Israel-Hamas war with senior Houthi official Mohammad Abdul Salam in Tehran on December 31.[79] Ahmadian praised the Houthis for their support of the Palestinians against Israeli “aggression.”

full report: https://www.understandingwar.org/backgrounder/iran-update-december-31-2023

619 posted on 01/01/2024 2:03:17 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 618 | View Replies]

To: nuconvert; bert; Eleutheria5; BeauBo
21DEC2023 Recording of radio communications of commercial ship under Houthi attack & the Navy's response. It's part of our feature on what private security teams are doing to protect ships traversing the Mandeb Strait & how they operate in general.

https://twitter.com/thewarzonewire/status/1737942347424665609

Inside The Private Security Forces Protecting Red Sea Shipping How armed contractors operate aboard ships and the ways they've been adapted to the eruption in hostilities around the Bab el-Mandeb strait.

https://www.thedrive.com/the-war-zone/inside-the-private-security-forces-protecting-red-sea-shipping

31DEC2023 After U.S. Navy Helicopters Sink Houthi Boats Are Strikes Next?
Navy MH-60 Sea Hawks sink Houthi boats after being fired upon as anti-ship ballistic missiles fly across the Red Sea.

https://www.thedrive.com/the-war-zone/after-u-s-navy-helicopters-sink-houthi-boats-are-strikes-next

Iran's Navy's IRIS Alborz has entered the Red Sea amid repeated threats by the IRGCterrorists-backed Houthis and U.S. sinking its small boats. Would note audio released last month of one of the distressed commercial tankers radioing for help saying Iran's naval forces were threatening to bomb his ship. Like the IRGCterrorists spy ship Behshad, the IRIS Alborz should be a legitimate military target for the U.S. and the UK under these circumstances.

IRIS Alborz commissioned in 1971, 1100 tons displacement. Has been modernized, but limited capability. 8 Noor anti-ship missiles, 1 Mark 8 Gun (4 1/2”). Legitimate military target & would recommend US sink if supporting Houthis or resupplying Houthis.

https://twitter.com/JasonMBrodsky/status/1741790033470775789

620 posted on 01/01/2024 8:00:20 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 619 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 581-600601-620621-640 ... 1,541-1,546 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
General/Chat
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson