Free Republic
Browse · Search
General/Chat
Topics · Post Article

Iran Update, December 18, 2023

The Houthis claimed to have conducted two drone attacks targeting the Norwegian-owned, Cayman Islands-flagged Swan Atlantic tanker and Swiss-owned, Panama-flagged MSC Clara container ship in the Red Sea on December 18.[69] The Houthi Navy initially deployed unspecified “craft” with armed personnel to direct the ships to alter course before attacking them.[70] The Houthi military spokesperson claimed that the group conducted drone attacks on the two ships.[71] US officials stated, on the other hand, that multiple unspecified “projectiles” had been launched from Houthi-controlled territory in Yemen.[72] It is unclear what munitions the Houthis used to conduct the attacks at the time of writing. The USS Carney responded to the Atlantic's distress call.[73] Western media reported that the Atlantic was damaged in the attack.[74] The UK Maritime Trade Operations reported an explosion in the water near a vessel south of the port of Mokha in Yemen.[75] The Houthis have expanded their attacks on maritime traffic around the Red Sea to include all vessels traveling to Israel after having threatened to do so on December 9 and 12.[76]

The Houthi anti-shipping attack campaign continues to achieve one of its desired effects of disrupting Red Sea maritime traffic headed to Israel. The British petroleum company BP, Taiwanese shipping company Evergreen Line, and Belgian oil tanker company Euronav announced on December 18 that they will suspend shipping operations in the Red Sea.[77] Norwegian energy group Equinor similarly stated that it had rerouted an unspecified number of ships away from the Red Sea.[78] The above companies cited the “deteriorating security situation” in the area and concern for the “safety of ships and crew.” The Hong Kong-based shipping company Orient Overseas Container Line (OOCL) similarly announced on December 17 that it would immediately stop shipping goods to and from Israel.[79] Global shipping giants, such as Mediterranean Shipping Company, CMA CGM, Maersk, and Hapag-Lloyd, previously announced that they would pause operations around the Red Sea but did not specify how it would affect their services to Israel.[80]

The Jordanian armed forces clashed with Iran-backed militias attempting to smuggle weapons and drugs through the Jordan-Syria border on December 18. [86] Jordanian state media stated that this was the largest armed cross-border weapons and drug smuggling operation in recent years.[87] Several Jordanian army personnel and smugglers were injured or killed during the clash. The Jordanian army similarly announced that it had neutralized an unspecified number of drug smugglers attempting to smuggle Captagon into the country on December 12.[88] The Syrian regime and Iran-backed militias mass produce the drug in Syria and smuggle it through Jordan to the Gulf Arab states, generating billions of dollars of revenue for the malign actors.[89] Jordanian and Western officials have stated that Iran and LH have been behind the surge in drug and weapons smuggling from southern Syria into Jordan.[90] The Jordanian armed forces conducted air strikes on Iran-linked drug factories in southern Syria in May 2023.[91]

Jordanian officials have been concerned about Iranian threats to their security beyond drug and weapons smuggling.
[92] The Jordanian Armed Forces shot down three drones that traveled into their airspace from Syria in August 2023, which Jordanian officials linked to Iran-backed militias in Syria.[93] Jordan also borders Iraq and the West Bank whose local governments and security institutions are infiltrated by Iran-backed militias that can then infiltrate Jordan from all directions. Some Western analysts have noted that Jordan is home to millions of displaced refugees from Iraq, Syria, and the West Bank which Iran can recruit for its militant groups.[94] Many of the Palestinian civil society organizations in Jordan are reportedly linked to Iran-sponsored groups.[95]

full report: https://www.understandingwar.org/backgrounder/iran-update-december-18-2023

602 posted on 12/20/2023 4:23:56 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 601 | View Replies ]


To: AdmSmith
Iran Update, December 19, 2023

The Jordanian Air Force conducted airstrikes on Iran-linked drug smuggling targets in Salkhad, Suwayda Province, Syria, on December 18.[80] The targets facilitated drug smuggling from Syria into Jordan and the Gulf states. The airstrikes follow small arms clashes between the Jordanian forces and Iran-linked individuals trying to smuggle drugs and weapons through the Jordan-Syria border between December 12 and 18.[81] The weapons included rocket launchers, anti-personnel mines, and other explosives. Jordan previously conducted airstrikes in Suwayda targeting Iran and LH-linked targets tied to drug smuggling in May 2023.[82]

Jordanian officials have previously expressed concern about Iran-linked security threats beyond drug and weapons smuggling.[83] The Jordanian armed forces shot down three drones that entered Jordan from Syria in August 2023.[84] Jordanian officials linked the drones to Iran-backed militias in Syria. Iranian-backed militias in Syria often use these drones to fly drugs over the border, but the drones could also be used to conduct attacks on civilian and military targets inside Jordan, including US forces stationed inside the country.[85] Iran-backed groups have also used Jordanian territory to smuggle weapons into Israel and the West Bank.[86]

full report: https://www.understandingwar.org/backgrounder/iran-update-december-19-2023

603 posted on 12/20/2023 4:25:59 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 602 | View Replies ]

Free Republic
Browse · Search
General/Chat
Topics · Post Article


FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson