Free Republic
Browse · Search
General/Chat
Topics · Post Article

Skip to comments.

Better Living Through Neanderthal Chemistry
Archaeology ^ | Tuesday, March 01, 2016 | editors

Posted on 03/02/2016 3:02:33 PM PST by SunkenCiv

Scientists from Leiden University and Delft University of Technology think that Neanderthals that lived at the site of Pech-de-l'Azé some 50,000 years ago may have used manganese dioxide to help kindle their fires. It had been thought that the blocks of manganese oxides found at Neanderthal sites in France were used for body decoration, but soot from their fires would have been readily available for use as a dark pigment. Why would Neanderthals go to the trouble to collect this mineral? Peter J. Heyes, Konstantinos Anastasakis, Wiebren de Jong, Annelies van Hoesel, Wil Roebroeks, and Marie Soressi found that although manganese dioxide is a non-combustible material, when ground into a powder and sprinkled on wood, it lowers the auto-ignition temperature of the wood and makes it easier to start a fire. The researchers suggest that the use of manganese dioxide for lighting fires provides new insight into Neanderthal cognitive capabilities. They also note that manganese dioxide is used today to make batteries.


(Excerpt) Read more at archaeology.org ...


TOPICS: History; Science; Travel
KEYWORDS: godsgravesglyphs; helixmakemineadouble; manganesedioxide; neandertal; neandertals; neanderthal; neanderthals
Navigation: use the links below to view more comments.
first previous 1-20, 21-29 last
To: gleeaikin

Good idea.


21 posted on 03/03/2016 4:57:19 AM PST by blam (Jeff Sessions For President)
[ Post Reply | Private Reply | To 16 | View Replies]

To: gleeaikin; blam; SunkenCiv
Nice, but terrible idea, about the usefulness of Alzheimer's disease.

However, there are indications that protection against AD gave the humans an advantage:

Previous studies have linked two forms of the gene-CD33-to Alzheimer's disease. While one CD33 variant, or allele, predisposes a person to the disease, the other appears to protect against it by preventing the formation of protein clumps in the brain.

Both humans and chimps had similar levels of the damaging version of CD33, meaning it must be the more ancient of the two variants. However, when the researchers looked at the protective variant, its levels were four times higher in humans than in chimps. This suggests that chimps—which usually die around the time their fertility is coming to an end—have little use for the protective variant. Indeed, chimps don’t seem to suffer from the same type of cognitive decline seen with Alzheimer's.
http://www.sciencemag.org/news/2015/11/anti-alzheimer-s-gene-may-have-led-rise-grandparents

Here is more on Chimps and AD
http://www.alzforum.org/news/research-news/what-primates-can-tell-us-about-normal-brain-aging

22 posted on 03/03/2016 6:01:08 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 16 | View Replies]

To: AdmSmith
The Neanderthal Theory

Abstract

In the past there have been numerous theories for the cause(s) of neurodiversity conditions like Autism, Asperger's syndrome, ADD/ADHD, OCD, Social phobia, Dyslexia, Dyscalculia, Bipolar, Schizophrenia, Tourette and Dyspraxia. Most of these theories can at best explain small parts of these diverse syndromes. Many of them extend their findings in spectacular ways to be able to claim to explain larger parts of neurodiversity with little success.

This theory approaches the problem from a new radical viewpoint. Instead of approaching neurodiversity conditions as disorders, brain defects or the result of poor socialization or parenting, it claims that neurodiversity is fully functional human variation.

All the areas that are central to neurodiversity are related to species-typical adaptations that vary widely between species. These include nonverbal signals, social organization, sensory acuteness, perception, motor skills, general preferences, sexuality, courtship, physical traits and biological adaptations. Some of this diversity is poorly understood and virtually unresearched and therefore is not published in peer-reviewed journals. Because of this lack of research, Aspie Quiz, an online questionnary, is heavily referenced for these traits.

Recent genetic research have demonstrated that Neanderthals contributed at least 1-4% to the non-African genome. Aspie Quiz have demonstrated in a large survey in the US population that Afroamericans have only 1/6 of the autism incidence of non-African groups.

Principal Component Analysis (PCA) of Aspie Quiz yields axes that seems to be related to the first Eurasian Homo, the formation of modern humans in Africa or South Asia and the hybridization between modern humans and Neanderthals in Eurasia. In Caucasians, these axises seems to be 1.8 million years, 150,000 years and 33,000 years. In Asians, they seem to be 1.8 million years, 130,000 years and 44,000 years.

23 posted on 03/03/2016 7:16:04 AM PST by blam (Jeff Sessions For President)
[ Post Reply | Private Reply | To 22 | View Replies]

To: blam

Thanks, I have to read more about this.


24 posted on 03/03/2016 7:27:38 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 23 | View Replies]

To: gleeaikin

I think marriage was the mutation that causes husbands to wander off ;-) (BTW and all joking aside, you are a saint to be taking care of yours)


25 posted on 03/03/2016 9:16:54 AM PST by cassiusking
[ Post Reply | Private Reply | To 16 | View Replies]

To: AdmSmith; blam; gleeaikin
Ulitimately, all such hypotheses are grounded in the pathological need to deny Neandertal ancestry -- now that it is established and starting to be accepted, the drumbeat of "Neandertal went extinct" has been on an uptick (in England at least) and these "sure, but their genes gave us diseases, like red hair and freckles, thankfully the sperm banks reject carrot-tops!"

26 posted on 03/03/2016 1:03:25 PM PST by SunkenCiv (Here's to the day the forensics people scrape what's left of Putin off the ceiling of his limo.)
[ Post Reply | Private Reply | To 22 | View Replies]

To: AdmSmith; SunkenCiv; wildbill; cassiusking; Beowulf9; Mariner; blam

First of all, let me assure that after having lived with it for 10 years and providing the at home death my husband wanted, I consider it a terrible thing. However, I was talking in the very cold blooded terms of survival of the fittest. A family that does not have to feed an elderly, soon to be useless, member has a greater chance of surviving. My husband had many of what are considered to be Neanderthal traits. I would not be surprised if he was more than 4%. Even though he could not remember for more than 15 or 20 seconds, we build a cabin together, he loved to rake the leaves off the moss, and sweep the sidewalk in front of the house. I can imagine an elderly Neanderthal still able to use his flint knapping skills or scraping a hide and thus being useful to the tribe even with Alzheimers. His genetics also included a large amount of northern Scottish, and 1/16 Canadian Indian. And he was what is called a “ginger”.

The time when my husband’s wandering became especially strong was a year or two before he went into serious, burdensome physical decline. In that period he was out sweeping the sidewalk, disappeared, and when I called the police they found him more than 1/2 a mile away still sweeping. Last time I let him out. He would also wake up at 4 am and want to go out and walk the city streets. Fortunately, he could not get out of the bedroom with the attached bathroom, and I always managed to wrestle him back into bed. I forgot to include the link to the comment which you answered. Here it is. Getting older, but no Alzheimers. ;-)

www.archaeology.org/issues/161-1501/features/2787-israel-neanderthal-epigenome-decoded


27 posted on 03/03/2016 2:31:48 PM PST by gleeaikin
[ Post Reply | Private Reply | To 22 | View Replies]

To: AdmSmith; SunkenCiv; blam; BenLurkin; All

I suspect that living in the jungle with food all around and no freezing temperatures, even if a chimp had something like Alzheimer’s, it would not have produced fatal wandering in the same way it could in a cold, frozen wasteland. Of course, we have also had a chance to observe elderly chimps in human captivity. I wonder if these are the ones tested for the damaging version of CD33 or if it was DNA from wild stool samples or something like that?


28 posted on 03/03/2016 2:36:41 PM PST by gleeaikin
[ Post Reply | Private Reply | To 22 | View Replies]

To: gleeaikin

But doesnt the article say that Neanderthals did not have the predisposition?

“Many genes associated with diseases—in particular psychiatric and neurological disorders such as Alzheimer’s disease, autism, and schizophrenia—also appear to be activated in modern humans but not Neanderthals. Carmel says the activation of these genes may have produced an evolutionary catch-22: bestowing a benefit, perhaps by changing the wiring of our brains, but also introducing an increased risk of disease.”


29 posted on 03/03/2016 4:43:53 PM PST by cassiusking
[ Post Reply | Private Reply | To 27 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20, 21-29 last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
General/Chat
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson