Free Republic
Browse · Search
General/Chat
Topics · Post Article

To: AdmSmith
The Neanderthal Theory

Abstract

In the past there have been numerous theories for the cause(s) of neurodiversity conditions like Autism, Asperger's syndrome, ADD/ADHD, OCD, Social phobia, Dyslexia, Dyscalculia, Bipolar, Schizophrenia, Tourette and Dyspraxia. Most of these theories can at best explain small parts of these diverse syndromes. Many of them extend their findings in spectacular ways to be able to claim to explain larger parts of neurodiversity with little success.

This theory approaches the problem from a new radical viewpoint. Instead of approaching neurodiversity conditions as disorders, brain defects or the result of poor socialization or parenting, it claims that neurodiversity is fully functional human variation.

All the areas that are central to neurodiversity are related to species-typical adaptations that vary widely between species. These include nonverbal signals, social organization, sensory acuteness, perception, motor skills, general preferences, sexuality, courtship, physical traits and biological adaptations. Some of this diversity is poorly understood and virtually unresearched and therefore is not published in peer-reviewed journals. Because of this lack of research, Aspie Quiz, an online questionnary, is heavily referenced for these traits.

Recent genetic research have demonstrated that Neanderthals contributed at least 1-4% to the non-African genome. Aspie Quiz have demonstrated in a large survey in the US population that Afroamericans have only 1/6 of the autism incidence of non-African groups.

Principal Component Analysis (PCA) of Aspie Quiz yields axes that seems to be related to the first Eurasian Homo, the formation of modern humans in Africa or South Asia and the hybridization between modern humans and Neanderthals in Eurasia. In Caucasians, these axises seems to be 1.8 million years, 150,000 years and 33,000 years. In Asians, they seem to be 1.8 million years, 130,000 years and 44,000 years.

23 posted on 03/03/2016 7:16:04 AM PST by blam (Jeff Sessions For President)
[ Post Reply | Private Reply | To 22 | View Replies ]


To: blam

Thanks, I have to read more about this.


24 posted on 03/03/2016 7:27:38 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 23 | View Replies ]

Free Republic
Browse · Search
General/Chat
Topics · Post Article


FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson