Free Republic
Browse · Search
General/Chat
Topics · Post Article

Skip to comments.

Dangerous bacterium hosts genetic remnant of life's distant past (RNA can do)
Yale University ^ | August 12, 2010 | Unknown

Posted on 08/12/2010 4:22:51 PM PDT by decimon

Within a dangerous stomach bacterium, Yale University researchers have discovered an ancient but functioning genetic remnant from a time before DNA existed, they report in the August 13 issue of the journal Science.

To the surprise of researchers, this RNA complex seems to play a critical role in the ability of the organism to infect human cells, a job carried out almost exclusively by proteins produced from DNA's instruction manual.

"What these cells are doing is using ancient RNA technology to control modern gene expression," said Ron Breaker, the Henry Ford II Professor of Molecular, Cellular and Developmental Biology at Yale, investigator for the Howard Hughes Medical Institute and senior author of the study.

In old textbooks, RNA was viewed simply as the chemical intermediary between DNA's instruction manual and the creation of proteins. However, Breaker's lab has identified the existence and function of riboswitches, or RNA structures that have the ability to detect molecules and control gene expression – an ability once believed to be possessed solely by proteins. Breaker and many other scientists now believe the first forms of life depended upon such RNA machines, which would have had to find ways to interact and carry out many of the functions proteins do today.

The new paper describes the complex interactions of two small RNA molecules and two larger RNA molecules that together influence the function of a self-splicing ribozyme, a structure many biologists had believed had no role other than to reproduce itself. The new study, however, suggests that in the pathogenic stomach bacterium Clostridium difficile, this RNA structure acts as a sort of sensor to help regulate the expression of genes, probably to help the bacterium manipulate human cells.

"They were though to be molecular parasites, but it is clear they are being harnessed by cells to do some good for the organism," Breaker said.

This is the sort of RNA structure would have been needed for life exist before the evolution of double-stranded DNA, with its instruction book for proteins that carry out almost all of life's functions today. If proteins are necessary to carry out life's functions, scientists need to explain how life arise without DNA's recipe. The answer to the chicken or egg question is RNA machines such as the one identified in the new study, Breaker said.

"A lot of sophisticated RNA gadgetry has gone extinct but this study shows that RNA has more of the power needed to carry out complex biochemistry," Breaker said. "It makes the spontaneous emergence of life on earth much more palatable."


TOPICS: History; Science
KEYWORDS: dna; godsgravesglyphs; helixmakemineadouble; rna

1 posted on 08/12/2010 4:22:54 PM PDT by decimon
[ Post Reply | Private Reply | View Replies]

To: neverdem; SunkenCiv

Primary ping.


2 posted on 08/12/2010 4:24:19 PM PDT by decimon
[ Post Reply | Private Reply | To 1 | View Replies]

To: decimon
Within a dangerous stomach bacterium, Yale University researchers have discovered an ancient but functioning genetic remnant from a time before DNA existed, they report in the August 13 issue of the journal Science.

yeah, sure they have. and if they look real hard, they'll find the Easter Bunny in there, too.

3 posted on 08/12/2010 4:25:38 PM PDT by the invisib1e hand (Gawd I love being an American.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: decimon; allmendream
"This is unpossible."


4 posted on 08/12/2010 4:31:10 PM PDT by James C. Bennett
[ Post Reply | Private Reply | To 1 | View Replies]

To: James C. Bennett
Very interesting. Ribosomal RNA transcription factors?

Looks like the “RNA world” hypothesis of abiogenesis just got another supporting data point.

5 posted on 08/12/2010 4:33:17 PM PDT by allmendream (Income is EARNED not distributed. So how could it be re-distributed?)
[ Post Reply | Private Reply | To 4 | View Replies]

To: martin_fierro

Fray ping.

Your bailiwick, no?


6 posted on 08/12/2010 4:40:53 PM PDT by decimon
[ Post Reply | Private Reply | To 5 | View Replies]

To: allmendream
Looks like the “RNA world” hypothesis of abiogenesis just got another supporting data point.

I don't think so. They have only found another mechanism by which complex chemical reactions can be controlled. They only say that RNA is less complex because they do not understand how it works. And it only "appears" to be less complex than DNA.

The same kind of people say the appendix does not currently serve a purpose. I used to remember in high school they said that the appendix was "vestigial".

7 posted on 08/12/2010 4:44:58 PM PDT by ColdSteelTalon (Light is fading to shadow, and casting its shroud over all we have known...)
[ Post Reply | Private Reply | To 5 | View Replies]

To: ColdSteelTalon
Who says RNA is less complex than DNA?

That is a strawman. RNA is more complex than DNA because it can perform enzymatic reactions. Although you are correct that less is understood about how it all works, because we are just now discovering miRNA’s, and the role they play in post transcriptional regulation of genes.

The fact that this RNA mechanism can act as a transcription factor IS a supporting data point for the “RNA world” hypothesis, because something like this would need to exist in order for there to be any sort of a complex ‘all RNA’ replicator.

8 posted on 08/12/2010 4:58:09 PM PDT by allmendream (Income is EARNED not distributed. So how could it be re-distributed?)
[ Post Reply | Private Reply | To 7 | View Replies]

To: decimon; StayAt HomeMother; Ernest_at_the_Beach; 21twelve; 240B; 24Karet; 2ndDivisionVet; 31R1O; ...

· join list or digest · view topics · view or post blog · bookmark · post a topic · subscribe ·

 
Gods
Graves
Glyphs
Thanks decimon!
an ancient but functioning genetic remnant from a time before DNA existed
To all -- please ping me to other topics which are appropriate for the GGG list.
GGG managers are SunkenCiv, StayAt HomeMother, and Ernest_at_the_Beach
 

·Dogpile · Archaeologica · Mirabilis.ca · LiveScience · Biblical Archaeology Society ·
· Discover · Bronze Age Forum · Science Daily · Science News · Eurekalert · PhysOrg ·
· Nat Geographic · Texas AM Anthro News · Yahoo Anthro & Archaeo · Google ·
· Archaeology · The Archaeology Channel · Excerpt, or Link only? · cgk's list of ping lists ·
· History topic · history keyword · archaeology keyword · paleontology keyword ·
· Science topic · science keyword · Books/Literature topic · pages keyword · ·


9 posted on 08/12/2010 5:19:43 PM PDT by SunkenCiv ("Fools learn from experience. I prefer to learn from the experience of others." -- Otto von Bismarck)
[ Post Reply | Private Reply | To 1 | View Replies]

To: ColdSteelTalon
The same kind of people say the appendix does not currently serve a purpose.

Yes, the appendix is a safe have for good bugs:

“Diseases causing severe diarrhea are endemic in countries without modern health and sanitation practices, which often results in the entire contents of the bowels, including the biofilms, being flushed from the body,” Parker said. He added that the appendix's location and position is such that it is expected to be relatively difficult for anything to enter it as the contents of the bowels are emptied.

“Once the bowel contents have left the body, the good bacteria hidden away in the appendix can emerge and repopulate the lining of the intestine before more harmful bacteria can take up residence,” Parker continued. “In industrialized societies with modern medical care and sanitation practices, the maintenance of a reserve of beneficial bacteria may not be necessary. This is consistent with the observation that removing the appendix in modern societies has no discernable negative effects.”
http://www.sciencedaily.com/releases/2007/10/071008102334.htm

10 posted on 08/13/2010 7:13:01 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 7 | View Replies]

To: allmendream
The fact that this RNA mechanism can act as a transcription factor IS a supporting data point for the “RNA world” hypothesis, because something like this would need to exist in order for there to be any sort of a complex 'all RNA' replicator.

Yes.
11 posted on 08/13/2010 7:14:50 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 8 | View Replies]

To: AdmSmith
The pieces of the puzzle just seem to keep falling into place. RNA enzymatic action, the intermediary between DNA and functional proteins, and now transcription control. What next?
12 posted on 08/13/2010 7:29:07 AM PDT by allmendream (Income is EARNED not distributed. So how could it be re-distributed?)
[ Post Reply | Private Reply | To 11 | View Replies]

To: allmendream

Probably something that has a name with a “some”-suffix.


13 posted on 08/13/2010 7:42:04 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 12 | View Replies]

To: ColdSteelTalon
The same kind of people say the appendix does not currently serve a purpose. I used to remember in high school they said that the appendix was "vestigial".

"Vestigial" does not necessarily mean having no function. An organ or feature can retain a purpose and still be sensibly called "vestigial" if that function is significantly reduced wrt ancestral and/or related organisms. This is certainly true of the human appendix. It is smaller and more degenerate wrt to related forms, and it's remaining functions are far less significant, and less essential, than providing for the full digestion of large quantities of raw vegetable matter.

14 posted on 08/15/2010 2:58:29 AM PDT by Stultis (Democrats. Still devoted to the three S's: Slavery, Segregation and Socialism.)
[ Post Reply | Private Reply | To 7 | View Replies]

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
General/Chat
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson