To: AdmSmith
The pieces of the puzzle just seem to keep falling into place. RNA enzymatic action, the intermediary between DNA and functional proteins, and now transcription control. What next?
12 posted on
08/13/2010 7:29:07 AM PDT by
allmendream
(Income is EARNED not distributed. So how could it be re-distributed?)
To: allmendream
Probably something that has a name with a “some”-suffix.
13 posted on
08/13/2010 7:42:04 AM PDT by
AdmSmith
(GCTGATATGTCTATGATTACTCAT)
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson