Free Republic
Browse · Search
General/Chat
Topics · Post Article

To: AdmSmith
The pieces of the puzzle just seem to keep falling into place. RNA enzymatic action, the intermediary between DNA and functional proteins, and now transcription control. What next?
12 posted on 08/13/2010 7:29:07 AM PDT by allmendream (Income is EARNED not distributed. So how could it be re-distributed?)
[ Post Reply | Private Reply | To 11 | View Replies ]


To: allmendream

Probably something that has a name with a “some”-suffix.


13 posted on 08/13/2010 7:42:04 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 12 | View Replies ]

Free Republic
Browse · Search
General/Chat
Topics · Post Article


FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson