Free Republic
Browse · Search
News/Activism
Topics · Post Article

Skip to comments.

Historic: In first, Shiite country will open an embassy in Israel
Arutz Sheva ^ | 18/11/22

Posted on 11/18/2022 5:47:34 AM PST by Eleutheria5

The Azerbaijani parliament on Friday announced its historic decision to open an embassy in Israel.

The embassy will be located in Tel Aviv, and will be the first embassy in Israel of a country with a Shi’ite majority and a Shi’ite government.

Outgoing Israeli Prime Minister Yair Lapid said: "I welcome the decision by the National Assembly of Azerbaijan to open an embassy in Israel. Azerbaijan is an important partner of Israel and home to one of the largest Jewish communities in the Muslim world. The decision to open an embassy reflects the depth of the relationship between our countries."

"This move is the result of the Israeli government's efforts to build strong diplomatic bridges with the Muslim world," he added.

.....

(Excerpt) Read more at israelnationalnews.com ...


TOPICS: Egypt; Extended News; Foreign Affairs; Israel; News/Current Events; Russia; Syria; War on Terror
KEYWORDS: abraham20; abrahamaccords; armenia; azerbaijan; embassy; erdogan; iran; iraq; israel; jerusalem; jordan; kurdistan; lebanon; letshavejerusalem; receptayyiperdogan; russia; shiite; shiites; syria; turkey; waronterror; yairlapid; yemen
Navigation: use the links below to view more comments.
first 1-2021-26 next last
Donald Trump's agenda keeps moving forward.
1 posted on 11/18/2022 5:47:34 AM PST by Eleutheria5
[ Post Reply | Private Reply | View Replies]

To: dennisw; Cachelot; Nix 2; veronica; Catspaw; knighthawk; Alouette; Optimist; weikel; Lent; GregB; ..
Middle East and terrorism, occasional political and Jewish issues Ping List. High Volume If you’d like to be on or off, please FR mail me.
2 posted on 11/18/2022 6:01:18 AM PST by SJackson (nations that are barren of liberties are also barren of groceries, Louis Fisher)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Eleutheria5

The Abraham Accords are the single greatest advance toward Middle East peace in history. And the media has basically censored all mention of it. If we lived in a halfway just world, Donald Trump would have been granted the Nobel Peace Prize with fanfare and by acclamation.


3 posted on 11/18/2022 6:09:11 AM PST by hinckley buzzard ( Resist the narrative)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Eleutheria5

Big FU to Iran and Biden.

Also, “this is apartheid!”


4 posted on 11/18/2022 6:10:01 AM PST by Jewbacca (The residents of Iroquois territory may not determine whether Jews may live in Jerusalem.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Eleutheria5

Better in Jerusalem, but still a plus.


5 posted on 11/18/2022 6:30:31 AM PST by Truth29
[ Post Reply | Private Reply | To 1 | View Replies]

To: Eleutheria5

Must be a typo. Secretary of State John Kerry said in 2016 that peace with Israel’s neighbors is impossible before they settle up with the Palestinians.
https://www.politico.com/story/2016/12/full-text-john-kerry-2016-israel-mideast-peace-speech-transcript-233014

F’in idiot


6 posted on 11/18/2022 6:39:14 AM PST by j.havenfarm (21 years on Free Republic, 12/10/21! More than 5000 replies and still not shutting up!)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Jewbacca

Azerbaijan and Iran are enemies as Iran does like it being an independent country. It was part of Iran pre-Russia, and Iran has millions of ethnic Azerbaijanis that look North to a freer country.

Israel gave Azerbaijan much of its tech for its successful war against Armenia last year.

Israel and Armenia don’t get along as pre-Israel there was a very large Christian Armenian community in the holy land. They were driven out during the formation of the Jewish state.


7 posted on 11/18/2022 6:56:46 AM PST by Renfrew
[ Post Reply | Private Reply | To 4 | View Replies]

To: Eleutheria5

I’m surprised no one has said it yet.

No Shi’ite, Sherlock!


8 posted on 11/18/2022 7:15:43 AM PST by Tom Tetroxide
[ Post Reply | Private Reply | To 1 | View Replies]

To: Eleutheria5

My friend went to Azerbaijan on a business trip years ago. He said the country was modern, the women wore Western wear, and he felt safer there than in Moscow.


9 posted on 11/18/2022 7:45:31 AM PST by chrisinoc
[ Post Reply | Private Reply | To 1 | View Replies]

To: Eleutheria5

from little acorns...


10 posted on 11/18/2022 9:09:04 AM PST by Chode (there is no fall back position, there's no rally point, there is no LZ... we're on our own. #FJB)
[ Post Reply | Private Reply | To 1 | View Replies]

To: AdmSmith; AnonymousConservative; Arthur Wildfire! March; Berosus; Bockscar; BraveMan; cardinal4; ...
Thanks Eleutheria5.
(excerpted from a FReepmail)

Iran has bullied Azerbaijan for decades, so, Israel and Azerbaijan have strong ties; Turks and Azerbaijanis are ethnically related, and Erdo doesn’t want Israel and Azerbaijan close. Russia and Turkey both help Azerbaijan (at different levels), but Russia and Armenia are both in the CSTO (at different levels) so Russia backs Armenia, and you’d think would have learned its lesson trying to deal with drones vs tanks.

Turkey’s Erdogan (hate him, or hate him more) has walked a tightrope, selling drones to Ukraine, buying and selling with Russia, getting his way in Syria for years (with the collusion of Putin), and managing other complex alliances and rivalries with his none-too-neighborly neighbors. As I’ve said many times, however bad Erdo is, whoever follows will be worse, and not by a little bit.

11 posted on 11/18/2022 10:03:37 AM PST by SunkenCiv (Imagine an imaginary menagerie manager imagining managing an imaginary menagerie.)
[ Post Reply | Private Reply | View Replies]

To: Renfrew

“ Israel and Armenia don’t get along as pre-Israel there was a very large Christian Armenian community in the holy land. They were driven out during the formation of the Jewish state.”

Not exactly, and I lived right next to the Armenian Quarter. It is true, the Armenians don’t get along great with Jews, mostly because their patriarchs are firmly anti-Semitic, so much so they refused to become Israeli citizens and opted for Jordanian citizenship with permanent resident status in Israel.

And it is also true that there is a particularly nasty sect of Haredi who live right next to them, who are crappy to everyone, including me and other Zionist. (This sect is firmly anti-Zionist.)

But the reason the Aremenian population shrank so dramatically during the British Period (post war) is the Soviet Union induced something like 90% of the population to leave for Armenia with generous land grants and stipends. (Most were very recent immigrants, fleeing issues elsewhere that swelled the Arementian population from the natural born population of about 3000 to something like 20,000.)

It was these new immigrants who turned around and went home.


12 posted on 11/18/2022 10:24:41 AM PST by Jewbacca (The residents of Iroquois territory may not determine whether Jews may live in Jerusalem.)
[ Post Reply | Private Reply | To 7 | View Replies]

Some excerpts (gotta go) from the Azerbaijan keyword, sorted:

13 posted on 11/18/2022 11:14:17 AM PST by SunkenCiv (Imagine an imaginary menagerie manager imagining managing an imaginary menagerie.)
[ Post Reply | Private Reply | View Replies]

To: Jewbacca

Thanks Jb.


14 posted on 11/18/2022 11:16:34 AM PST by SunkenCiv (Imagine an imaginary menagerie manager imagining managing an imaginary menagerie.)
[ Post Reply | Private Reply | To 12 | View Replies]

To: hinckley buzzard

Yes. Ignored.

Kushner actually did a good job.


15 posted on 11/18/2022 12:09:59 PM PST by ifinnegan (Democrats kill babies and harvest their organs to sell)
[ Post Reply | Private Reply | To 3 | View Replies]

To: SunkenCiv
Article 7. The Azerbaijan State
I. The Azerbaijan State is a democratic, law-governed, secular, unitary republic.

https://www.constituteproject.org/constitution/Azerbaijan_2016.pdf?lang=en

video
The city of #Piranshahr in #Kurdistan /West Azerbaijan province in #Iran has become a real battlefield 18/11/22
https://twitter.com/botinkurdistany/status/1593704081394388992

16 posted on 11/18/2022 12:49:35 PM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 11 | View Replies]

To: SunkenCiv; All

Ok, it is also encouraging that Israel has by now relations with both, Azeris and Turks.. Not letting outside (Armenian front) conflict effect get in the way. Vital against the mullahcracy GOLIATH.


17 posted on 11/18/2022 1:43:00 PM PST by Conservat1
[ Post Reply | Private Reply | To 11 | View Replies]

To: Conservat1; nuconvert

Timeline of the fall of the Mullahs https://freerepublic.com/focus/chat/4099233/posts?page=127#127


18 posted on 11/18/2022 1:47:51 PM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 17 | View Replies]

To: hinckley buzzard
The Abraham Accords are the single greatest advance toward Middle East peace in history. And the media has basically censored all mention of it. If we lived in a halfway just world, Donald Trump would have been granted the Nobel Peace Prize with fanfare and by acclamation.

Right on every point.

19 posted on 11/19/2022 12:12:09 AM PST by GOPJ (Thinking with your emotions is like feeling with abstract mathematics.analytical engine mechanic - )
[ Post Reply | Private Reply | To 3 | View Replies]

To: hinckley buzzard

It is a halfway just world, but the wrong half.


20 posted on 11/19/2022 7:32:01 AM PST by Eleutheria5 (Free country? Good morning, Rip. )
[ Post Reply | Private Reply | To 3 | View Replies]


Navigation: use the links below to view more comments.
first 1-2021-26 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
News/Activism
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson