Free Republic
Browse · Search
General/Chat
Topics · Post Article

Skip to comments.

What Was Arabia Like Before Islam? | DOCUMENTARY [38:22]
YouTube ^ | March 29, 2026 | Para Bellum

Posted on 08/02/2026 6:22:43 AM PDT by SunkenCiv

In this video, we explore the history of Arabia before Islam, starting with the prehistoric period when the region was far greener than today, filled with lakes, rivers, and wildlife. We follow the transformation of this landscape into desert and how early communities adapted to it. 
What Was Arabia Like Before Islam? | DOCUMENTARY | 38:22 
Para Bellum | 140K subscribers | 1,362,096 views | March 29, 2026
What Was Arabia Like Before Islam? | DOCUMENTARY | 38:22 | Para Bellum | 140K subscribers | 1,362,096 views | March 29, 2026

(Excerpt) Read more at youtube.com ...


TOPICS: History; Science; Travel
KEYWORDS: arabia; axum; dilmun; epigraphyandlanguage; godsgravesglyphs; hadramaut; himyar; indusvalley; magan; mecca; mesopotamia; muslimtruth; nabataeans; petra; qataban; saba

Click here: to donate by Credit Card

Or here: to donate by PayPal

Or by mail to: Free Republic, LLC - PO Box 9771 - Fresno, CA 93794

Thank you very much and God bless you.

Most people think of Arabia only as the birthplace of Islam, but long before the 7th century the peninsula was home to complex societies, powerful kingdoms, and vast trade networks that connected the ancient world. 

...You will learn about the first urban centers in Arabia, including the trade civilizations of Dilmun and Magan, and how they linked Mesopotamia with the Indus Valley. We examine the rise of the great South Arabian kingdoms such as Saba, Qataban, Hadramaut, and Himyar, their advanced irrigation systems, and their control over the lucrative trade in frankincense and myrrh. 

We also look at the nomadic Arab tribes mentioned in Assyrian and Babylonian sources, their role in regional politics, and their interactions with empires like Assyria, Persia, and Rome. The video covers the Nabataeans and their capital Petra, one of the most remarkable cities of the ancient world, as well as the development of the Arabic script. 

Finally, we turn to Mecca and Medina before Islam, exploring their economic and religious importance, the role of the Kaaba, and the social changes that set the stage for the rise of Islam. 

This is the story of Arabia before Islam, a region that was far more complex, connected, and historically significant than it is often assumed.
YouTube transcript reformatted at textformatter.ai *may* follow.

1 posted on 08/02/2026 6:22:43 AM PDT by SunkenCiv
[ Post Reply | Private Reply | View Replies]

To: SunkenCiv

Mecca didn’t exist.


2 posted on 08/02/2026 6:25:00 AM PDT by CodeToad
[ Post Reply | Private Reply | To 1 | View Replies]

To: 240B; 75thOVI; Adder; albertp; asgardshill; At the Window; bitt; blu; BradyLS; cajungirl; ...
The weekly digest list of topics will be down below. Slow week.

3 posted on 08/02/2026 6:25:42 AM PDT by SunkenCiv (The Demagogic Party is just a collection of violent, rival street gangs.)
[ Post Reply | Private Reply | View Replies]

Excerpts from the Mecca & Petra keywords, sorted:

4 posted on 08/02/2026 6:31:12 AM PDT by SunkenCiv (The Demagogic Party is just a collection of violent, rival street gangs.)
[ Post Reply | Private Reply | View Replies]

To: SunkenCiv

Before Islam they prayed five times a day to a rock.


5 posted on 08/02/2026 6:35:07 AM PDT by BenLurkin (The above is not a statement of fact. It is opinion or satire. Or both.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: SunkenCiv

I recall a substantial art exhibition in one of the big museums about pre-Islamic art in Arabia. It is remarkable how dramatic the regression was after the contagion was unleashed. Pre-Mohammad, the region was a hub of complex trade networks with a culture that was open to cultural diffusion. Islam changed all that.


6 posted on 08/02/2026 6:50:43 AM PDT by sphinx
[ Post Reply | Private Reply | To 1 | View Replies]

To: SunkenCiv

One time I started digging into the claim of how advanced Islam was for the world and what I saw was Islam would drag a civilized country down into backwardness and irrelevance in about 40 or 50 years, I think one country still seemed to produce some advances for about 170 years but I forget which countries and the detailed information.


7 posted on 08/02/2026 6:56:10 AM PDT by ansel12
[ Post Reply | Private Reply | To 1 | View Replies]

To: BenLurkin

And that’s different how?


8 posted on 08/02/2026 7:02:44 AM PDT by SunkenCiv (The Demagogic Party is just a collection of violent, rival street gangs.)
[ Post Reply | Private Reply | To 5 | View Replies]

mark


9 posted on 08/02/2026 7:06:54 AM PDT by Bigg Red ( Lord, make me an instrument of your peace.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: SunkenCiv

I think the standard story is that Mohammed converted a portion of Saudi Arabia and conquered the rest. With the exception of distant Indonesia, all Muslim countries were conquered.

The history of Mohammed is murky. He may be a legend, no more real than Paul Bunyan.


10 posted on 08/02/2026 7:17:49 AM PDT by ChessExpert (Infidels of the world unite against the evil that is Islam.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: SunkenCiv

Arabia before and during the rise of Islam was a fascinating place. And as Islam began to rise, everyone realized what a problem it would be. There are records of the King of Ethiopia sending an offer to the Byzantines to create a joint army to invade and destory the Islamic forces and strangle Islam in the crib. And the Byzantines and Persians - foes for about 600 years- joined together to try to defeat Islam and stop it from taking over. The late 500s / early 600s AD were a fascinating period.


11 posted on 08/02/2026 7:50:57 AM PDT by Opinionated Blowhard (When the people find that they can vote themselves money, that will herald the end of the republic.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: CodeToad; SunkenCiv
That's an accurate description up until about the 6th century.

And they should have included 363, the year of the earthquake that devastated Petra;
https://en.wikipedia.org/wiki/363_Galilee_earthquake

Furthermore, Mecca did not yet exist as a city in 570 during the Aksumite–Persian Wars.

Source Crone, Patricia. Meccan Trade and the Rise of Islam. Princeton University Press, 1987:

https://syifafauzii5.wordpress.com/wp-content/uploads/2018/05/meccan-trade-and-the-rise-of-islam.pdf

12 posted on 08/02/2026 8:12:34 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 2 | View Replies]

To: AdmSmith

For further good info, see Dr Jay Smith, Calvary Chapel Chino Hills, July 6, 2025. Both in PowerPoint and video. Probably on youtube.


13 posted on 08/02/2026 8:23:46 AM PDT by CodeToad
[ Post Reply | Private Reply | To 12 | View Replies]

To: CodeToad

“DISMANTLING ISLAM HISTORICALLY” A Response to Raymond Ibrahim on why Muhammad didn’t Exist Dr Jay Smith Calvary Chapel Chino Hills July 6, 2025

https://calvarycch.org/wp-content/uploads/Dismantling-Islam.pdf

82 pages


14 posted on 08/02/2026 8:54:08 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 13 | View Replies]

https://calvarycch.org/two-new-findings-that-mohammed-didnt-exist/


15 posted on 08/02/2026 8:58:58 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 14 | View Replies]

To: SunkenCiv; All

Thanks for posting. History BUMP!


16 posted on 08/02/2026 9:23:14 AM PDT by PGalt (Past Peak Civilization?)
[ Post Reply | Private Reply | To 1 | View Replies]

To: SunkenCiv

It’s not. Same moon “ god”, different name.


17 posted on 08/02/2026 9:46:21 AM PDT by cowboyusa (YESHUA IS KING OF AMERICA!)
[ Post Reply | Private Reply | To 8 | View Replies]

To: AdmSmith

Yep. That’s him.


18 posted on 08/02/2026 11:04:53 AM PDT by CodeToad
[ Post Reply | Private Reply | To 14 | View Replies]

To: SunkenCiv

Hmm.

Yemen WAS Christian.

Medina WAS a Sanctuary City...


19 posted on 08/02/2026 5:40:51 PM PDT by Does so (Book:"The Party of Death"...Dem☭¢rats ™ ® © ≣ ½⅓⅔¼¾ ⅛⅜⅝⅞ ⅓ ⅕ ⅖ ⅗ ⅘ ⅙ ⅚)
[ Post Reply | Private Reply | To 1 | View Replies]

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
General/Chat
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson