Free Republic
Browse · Search
General/Chat
Topics · Post Article

Skip to comments.

Major Discoveries at Göbekli Tepe, Karahan Tepe, Sefer Tepe & Sayburç | Taş Tepeler | Megalithomania [17:09]
YouTube ^ | November 29, 2025 | MegalithomaniaUK

Posted on 11/30/2025 9:04:27 AM PST by SunkenCiv

A series of important new discoveries have been revealed in Southeast Turkiye, announced to the world this week marking the 5th anniversary of the Taş Tepeler project. As well as revealing new structures, carvings and T-pillars at the sites in this video, stunning artefacts and statues from Göbekli Tepe, Karahan Tepe, Sefer Tepe, Sayburç and Gürcütepe have been placed on display at Karahan Tepe's visitors centre all dating back to over 11,000 years old. 
Major Discoveries at Göbekli Tepe, Karahan Tepe, Sefer Tepe & Sayburç | Taş Tepeler | 17:09 
MegalithomaniaUK | 243K subscribers | 38,014 views | November 29, 2025
Major Discoveries at Göbekli Tepe, Karahan Tepe, Sefer Tepe & Sayburç | Taş Tepeler | 17:09 | MegalithomaniaUK | 243K subscribers | 38,014 views | November 29, 2025

(Excerpt) Read more at youtube.com ...


TOPICS: History; Science; Travel
KEYWORDS: anatolia; epigraphyandlanguage; gobeklitepe; godsgravesglyphs; gurcutepe; karahantepe; megaliths; neolithic; sayburc; sefertepe; tastepeler; turkey

Click here: to donate by Credit Card

Or here: to donate by PayPal

Or by mail to: Free Republic, LLC - PO Box 9771 - Fresno, CA 93794

Thank you very much and God bless you.


Navigation: use the links below to view more comments.
first 1-2021-22 next last
Comment #1 Removed by Moderator

Comment #2 Removed by Moderator

To: 240B; 75thOVI; Adder; albertp; asgardshill; At the Window; bitt; blu; BradyLS; cajungirl; ...
The weekly digest list of topics is up top.
The accent of the narrator probably wreaked havoc with YouTube's transcript generator. As always, feel free to post an AI transcript, just don't ping me about it.

3 posted on 11/30/2025 9:07:08 AM PST by SunkenCiv (Kudos to the Admin Moderator, reason: "Randspam" [ 4354167 ])
[ Post Reply | Private Reply | View Replies]

To: 240B; 75thOVI; Adder; albertp; asgardshill; At the Window; bitt; blu; BradyLS; cajungirl; ...
The weekly digest list of topics WAS up top, it and the transcript was removed by the mod.
The accent of the narrator probably wreaked havoc with YouTube's transcript generator. As always, feel free to post an AI transcript, but don't tell me about it.

4 posted on 11/30/2025 9:09:49 AM PST by SunkenCiv (Kudos to the Admin Moderator, reason: "Randspam" [ 4354167 ])
[ Post Reply | Private Reply | View Replies]

To: SunkenCiv

What’s this “Turkiye” crap. It’s Turkey!

Do we call Germany “Deutschland” or Spain “Espana” or Italy “Italia” or Sweden “Sverige”...?


5 posted on 11/30/2025 9:13:11 AM PST by aquila48 (Do not let them make you "care" ! Guilting you is how they control you. )
[ Post Reply | Private Reply | View Replies]

To: SunkenCiv
Peter describes this in IIPeter 3:

5 For this they willingly are ignorant of, that by the word of God the heavens were of old, and the earth standing out of the water, and in the water,

6 Whereby the world that then was, being ouerflowed with water, perished.

Genesis 1:2

6 posted on 11/30/2025 9:21:33 AM PST by Just mythoughts (Matthew 24:32 Now learn a parable of the fig tree; When his branch is yet tender, .........)
[ Post Reply | Private Reply | To 4 | View Replies]

To: SunkenCiv

Cool beans!
Bookmark


7 posted on 11/30/2025 9:27:21 AM PST by CaptainPhilFan (God gave them over to a depraved mind, to do things which are improper and repulsive, Rom 1:28)
[ Post Reply | Private Reply | To 3 | View Replies]

To: aquila48
California, Oregon, and Washington state have often been referred to as "The Left Coast", which is much more apropos. I don't worry about that either.

8 posted on 11/30/2025 9:42:19 AM PST by SunkenCiv (Kudos to the Admin Moderator, reason: "Randspam" [ 4354167 ])
[ Post Reply | Private Reply | To 5 | View Replies]

To: SunkenCiv

It’s super exciting, and since they’ve only started digging in about 5% of the area, there’ll be a ton of awesome finds over the next 50 years.


9 posted on 11/30/2025 9:42:31 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 3 | View Replies]

To: CaptainPhilFan
😎

10 posted on 11/30/2025 9:42:55 AM PST by SunkenCiv (Kudos to the Admin Moderator, reason: "Randspam" [ 4354167 ])
[ Post Reply | Private Reply | To 7 | View Replies]

To: Just mythoughts

No, he doesn’t.


11 posted on 11/30/2025 9:43:26 AM PST by SunkenCiv (Kudos to the Admin Moderator, reason: "Randspam" [ 4354167 ])
[ Post Reply | Private Reply | To 6 | View Replies]

To: SunkenCiv
You wait and see ... cause Genesis 1: 2 describes this self same ‘flood’... and Peter knew about the willingly ignorance... Jeremiah as well describes this flood ... where the Heavenly Father calls His adorables ‘sottish’... means stupid.
12 posted on 11/30/2025 10:01:06 AM PST by Just mythoughts (Matthew 24:32 Now learn a parable of the fig tree; When his branch is yet tender, .........)
[ Post Reply | Private Reply | To 11 | View Replies]

To: Just mythoughts

And no sign of flood at the sites, so, no.


13 posted on 11/30/2025 10:16:36 AM PST by SunkenCiv (Kudos to the Admin Moderator, reason: "Randspam" [ 4354167 ])
[ Post Reply | Private Reply | To 12 | View Replies]

To: AdmSmith

I’m glad one of the described sites is getting excav’d by some Japanese, not the tourist-center-building, bring-up-the-bulldozers Turks.


14 posted on 11/30/2025 10:18:05 AM PST by SunkenCiv (Kudos to the Admin Moderator, reason: "Randspam" [ 4354167 ])
[ Post Reply | Private Reply | To 9 | View Replies]

To: SunkenCiv

Yes, the authorities are “reconstructing” the site and burying areas where there may be important artifacts.


15 posted on 11/30/2025 10:38:39 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 14 | View Replies]

To: AdmSmith

Looks to me like 2 different peoples used the sites - those that built with large stones/slabs, and those who built with the much cruder small stones of the enclosures, who also used old worn out statues from the slab builders for building material - a common practice later on.

The open mouthed head is reminiscent of 19th-early 20th century fairs that had painted statuary clowns with similar open mouths - toss a ball at it, and if you get it in the mouth, you get a prize.


16 posted on 11/30/2025 10:41:25 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 9 | View Replies]

To: AdmSmith

Yes, the authorities are “reconstructing” the site and burying areas where there may be important artifacts.


Another common practice in the ME and Egypt. Want to know where some important site lies buried, just look at were spoils from a current dig are dumped. Reason: local help gets paid to remove the site over burdens and then again to remove it from the site buried under the spoils. This is especially prevalent in Egypt - where the practice may have been invented.


17 posted on 11/30/2025 10:46:03 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 15 | View Replies]

To: PIF

More questions than answers, as is to be expected with such ancient artifacts.


18 posted on 11/30/2025 10:53:07 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 16 | View Replies]

To: SunkenCiv

Good stuff!
I watched the whole thing, which is amazing.


19 posted on 11/30/2025 12:47:20 PM PST by ComputerGuy
[ Post Reply | Private Reply | To 3 | View Replies]

To: ComputerGuy

I enjoyed the rambling, impromptu presentation so much that the accent didn’t bug me.


20 posted on 11/30/2025 1:27:11 PM PST by SunkenCiv (Kudos to the Admin Moderator, reason: "Randspam" [ 4354167 ])
[ Post Reply | Private Reply | To 19 | View Replies]


Navigation: use the links below to view more comments.
first 1-2021-22 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
General/Chat
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson