To: 240B; 75thOVI; Adder; albertp; asgardshill; At the Window; bitt; blu; BradyLS; cajungirl; ...
The weekly digest list of topics is up top.
The accent of the narrator probably wreaked havoc with YouTube's transcript generator. As always, feel free to post an AI transcript, just don't ping me about it.

3 posted on
11/30/2025 9:07:08 AM PST by
SunkenCiv
(Kudos to the Admin Moderator, reason: "Randspam" [ 4354167 ])
To: SunkenCiv
7 posted on
11/30/2025 9:27:21 AM PST by
CaptainPhilFan
(God gave them over to a depraved mind, to do things which are improper and repulsive, Rom 1:28)
To: SunkenCiv
It’s super exciting, and since they’ve only started digging in about 5% of the area, there’ll be a ton of awesome finds over the next 50 years.
9 posted on
11/30/2025 9:42:31 AM PST by
AdmSmith
(GCTGATATGTCTATGATTACTCAT)
To: SunkenCiv
Good stuff!
I watched the whole thing, which is amazing.
To: SunkenCiv
Where all da wimmen at?
Seems like there are few images of women..seems curious.
21 posted on
11/30/2025 1:52:27 PM PST by
Adder
(End fascism...defeat all Democrats.)
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson