Free Republic
Browse · Search
General/Chat
Topics · Post Article

To: 240B; 75thOVI; Adder; albertp; asgardshill; At the Window; bitt; blu; BradyLS; cajungirl; ...
The weekly digest list of topics is up top.
The accent of the narrator probably wreaked havoc with YouTube's transcript generator. As always, feel free to post an AI transcript, just don't ping me about it.

3 posted on 11/30/2025 9:07:08 AM PST by SunkenCiv (Kudos to the Admin Moderator, reason: "Randspam" [ 4354167 ])
[ Post Reply | Private Reply | View Replies ]


To: SunkenCiv

Cool beans!
Bookmark


7 posted on 11/30/2025 9:27:21 AM PST by CaptainPhilFan (God gave them over to a depraved mind, to do things which are improper and repulsive, Rom 1:28)
[ Post Reply | Private Reply | To 3 | View Replies ]

To: SunkenCiv

It’s super exciting, and since they’ve only started digging in about 5% of the area, there’ll be a ton of awesome finds over the next 50 years.


9 posted on 11/30/2025 9:42:31 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 3 | View Replies ]

To: SunkenCiv

Good stuff!
I watched the whole thing, which is amazing.


19 posted on 11/30/2025 12:47:20 PM PST by ComputerGuy
[ Post Reply | Private Reply | To 3 | View Replies ]

To: SunkenCiv

Where all da wimmen at?

Seems like there are few images of women..seems curious.


21 posted on 11/30/2025 1:52:27 PM PST by Adder (End fascism...defeat all Democrats.)
[ Post Reply | Private Reply | To 3 | View Replies ]

Free Republic
Browse · Search
General/Chat
Topics · Post Article


FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson