Free Republic
Browse · Search
General/Chat
Topics · Post Article

Skip to comments.

Anti-aging drug extends life up to 25%, staves off frailty and disease
New Atlas ^ | JULY 18, 2024 | Bronwyn Thompson

Posted on 07/22/2024 12:00:37 PM PDT by Red Badger

For the first time, scientists have demonstrated how a specific protein increases in our organs as we get older and actively promotes the aging process. By blocking this activity, it could not only help us live longer, but slow the physical decline that is, right now, an inevitable part of aging.

Researchers at Duke-NUS Medical School in Singapore have previously undertaken three different studies to examine interleukin-11 (IL-11) protein expression and its role in heart and kidney, liver and lung health. The lattermost research has led to an experimental anti-IL-11 therapy that's currently in clinical trials to treat fibrotic lung disease.

Building on this work, the team identified IL-11's role in the aging process, with its increased production leading to fat accumulating in the liver and abdomen, as well as reduced muscle mass and strength. By blocking this protein expression, these hallmarks of aging could be drastically reduced.

[SNIP]

In a preclinical mouse model, the researchers found that deleting this protein provided protection against age-related decline, frailty and disease. Deleting the IL-11 gene in mice extended the lives of the animals by an average of 24.9%. When mice were given an anti-IL-11 therapeutic at 75 weeks of age (the equivalent of around 55 human years) until death, the average lifespan of male mice was increased by 22.5% and 25% in female mice.

The mice didn't just live longer, they were shielded from key signs of aging. Anti-IL-11 therapy boosted metabolism, with the animals producing calorie-burning brown fat, not problematic stores of white fat, blocked the loss of muscle mass and strength, and protected against multimorbidity and cardiometabolic diseases.

(Excerpt) Read more at newatlas.com ...


TOPICS: Education; Health/Medicine; Military/Veterans; Society
KEYWORDS: antiaging; hh2; hivaging; interleukin11
Navigation: use the links below to view more comments.
first 1-2021-29 next last

1 posted on 07/22/2024 12:00:37 PM PDT by Red Badger
[ Post Reply | Private Reply | View Replies]

To: Red Badger

MORE INFO HERE:

https://corporate.dukehealth.org/news/interleukin-linked-muscle-loss-fat-accumulation-aging


2 posted on 07/22/2024 12:00:59 PM PDT by Red Badger (Homeless veterans camp in the streets while illegals are put up in 5 Star hotels....................)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Red Badger

AND HERE:

https://www.nature.com/articles/s41586-024-07701-9


3 posted on 07/22/2024 12:01:35 PM PDT by Red Badger (Homeless veterans camp in the streets while illegals are put up in 5 Star hotels....................)
[ Post Reply | Private Reply | To 1 | View Replies]

To: ConservativeMind

Ping.....................


4 posted on 07/22/2024 12:04:09 PM PDT by Red Badger (Homeless veterans camp in the streets while illegals are put up in 5 Star hotels....................)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Red Badger

I’ll-11 does other things, too.

An anti-IL-11 would need to be injected subcutaneously.


5 posted on 07/22/2024 12:05:21 PM PDT by ifinnegan (Democrats kill babies and harvest their organs to sell)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Red Badger

Bump


6 posted on 07/22/2024 12:05:28 PM PDT by stockpirate (A group of baboons is referred to as a "Congress" of baboons.)
[ Post Reply | Private Reply | To 2 | View Replies]

To: Red Badger

Unfortunately, it is not available and they don’t say when it might be.

Bummer!


7 posted on 07/22/2024 12:20:13 PM PDT by ConservativeMind (Trump: Befuddling Democrats, Republicans, and the Media for the benefit of the US and all mankind.)
[ Post Reply | Private Reply | To 4 | View Replies]

To: Red Badger

As long as it doesn’t return my voice to tenor.


8 posted on 07/22/2024 12:28:37 PM PDT by moovova ("The NEXT ELECTION is the most important election of our lifetimes!“ LOL...)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Red Badger

To late.


9 posted on 07/22/2024 12:49:03 PM PDT by Leep (Leftardism strikes 1 in )
[ Post Reply | Private Reply | To 1 | View Replies]

To: ConservativeMind

I’ll volunteer as a test subject.


10 posted on 07/22/2024 1:26:56 PM PDT by Hootowl
[ Post Reply | Private Reply | To 7 | View Replies]

To: Red Badger

So, does that mean that I’ll get another 22.5 years above ground if I take the stuff?

Means I get to see Apophis 3 times?


11 posted on 07/22/2024 1:58:44 PM PDT by SuperLuminal ( Where is Samuel Adams when we so desperately need him)
[ Post Reply | Private Reply | To 1 | View Replies]

To: SuperLuminal

If it hits you’ll only see it once.......


12 posted on 07/22/2024 3:27:28 PM PDT by Red Badger (Homeless veterans camp in the streets while illegals are put up in 5 Star hotels....................)
[ Post Reply | Private Reply | To 11 | View Replies]

To: Red Badger

FOUR MORE YEARS!


13 posted on 07/22/2024 3:37:40 PM PDT by Libloather (Why do climate change hoax deniers live in mansions on the beach?)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Red Badger

Interleukin-11! So that’s why my jeans’ waistbands are getting tighter. I knew it had to be something like that.


14 posted on 07/22/2024 3:39:58 PM PDT by Billthedrill
[ Post Reply | Private Reply | To 1 | View Replies]

To: Red Badger
adrenochrome
15 posted on 07/22/2024 5:25:43 PM PDT by MikelTackNailer (Fortunately despite aging I've eluded the snares of aquired wisdom.)
[ Post Reply | Private Reply | To 12 | View Replies]

To: Red Badger
"If it hits you’ll only see it once......."

Well, let's see...
The first go-by will be inside the distance to the moon...
So that will be a spectacular sight...

However, NASA_DEI has big plans for a half dozen experiments during that fly-by...
It's almost a certainty that woke science will result in disrupting Apophis' original trajectory...
Any disruption reduces the fly-by distance, if not on the first pass certainly the second pass (which was already less than 1/2 the first fly-by distance...
So if I make it to about 103, I'll most likely see it as the last thing I see...

On the optimistic side, we would finally get rid of the American Communist Party AND the 200-million migrant-invader vermin who will be here by then...

If it misses on fly-by 2, the 3rd fly-by is an impact lock...

To see the 3rd fly-by (if there is one and it missed on 1&2) I will be about 143...
Gonna have to eat more carrots to keep my eyesight sharp...

16 posted on 07/22/2024 7:33:11 PM PDT by SuperLuminal ( Where is Samuel Adams when we so desperately need him)
[ Post Reply | Private Reply | To 12 | View Replies]

To: Red Badger

The primary reason scientists are researching anti-aging drugs is because HIV causes its infected to prematurely age 14 years. Must be a bunch of homosexuals who are going to die 14 years early.


17 posted on 07/22/2024 8:32:34 PM PDT by NetAddicted (MAGA2024)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Red Badger

The scientists say IL-11 is what makes older people gain weight? BS! Not regulating caloric intake and not exercising is what makes one fat. I don’t trust those ‘scientists.’


18 posted on 07/22/2024 8:40:48 PM PDT by NetAddicted (MAGA2024)
[ Post Reply | Private Reply | To 1 | View Replies]

To: AdmSmith; AnonymousConservative; Arthur Wildfire! March; Berosus; Bockscar; BraveMan; cardinal4; ...

19 posted on 07/22/2024 9:12:29 PM PDT by SunkenCiv (Putin should skip ahead to where he kills himself in the bunker.)
[ Post Reply | Private Reply | View Replies]

To: Red Badger; SunkenCiv
From the article in Nature:
IL-11 is progressively upregulated across tissues with age, probably as an alarmin-type response to age-related pathogenic factors that include cytokines, proteotoxic stress, oxidative species and DNA damage, among others. We propose that the pleiotropic benefits seen with inhibition of IL-11 reflect its modulation of multiple ageing pathways (such as ERK, AMPK, mTOR and JAK–STAT3), as seen using polypharmacy in flies. IL-11 has not been extensively studied and was not previously thought to be important for ageing, however SNPs at the IL11 locus are associated with osteoarthritis and menopause, and IL-11 is linked with senescence and diseases that are common in older people.

Mouse mortality in old age is often cancer-related and our end-of-life autopsy data support the notion that inhibition of IL-11 significantly reduces age-related cancers. Of note, IL-11 is important for tumorigenesis and tumour immune evasion and clinical trials of anti-IL-11 in combination with immunotherapy to treat cancer are planned.

We show here that a pro-inflammatory cytokine can affect affect age-related decline and lifespan in a mammal. The relative contributions of canonical (JAK–STAT3) and non-canonical (MEK–ERK) IL-11 signalling, alone or in combination, for ageing phenotypes remain to be determined.

Inhibition of ERK or mTOR or activation of AMPK by trametinib, rapamycin or metformin, respectively, increase lifespan in model organisms and such drugs are advocated by some for use in humans. However, these agents have on- and off-target toxicities along with variable, and sometimes detrimental, effects on healthspan and inflammation12,13,35,49. Our data suggest that anti-IL-11 therapy, which has a reassuring safety profile and is currently in early-stage clinical trials for fibroinflammatory diseases, is a potentially translatable approach for extending human healthspan and lifespan.

Looks very interesting

X203 is develepoed by https://www.enleofen.com/ funded by Boehringer Ingelheim.
BI Partners with Enleofen to Develop First-in-Class Anti-IL-11 Therapies for a Range of Fibrotic Diseases
Acquisition of worldwide exclusive rights adds extensive anti-IL-11 platform to Boehringer Ingelheim pipeline portfolio
Boehringer Ingelheim aims to develop therapies for multiple fibrotic human disorders, including non-alcoholic steatohepatitis (NASH) and interstitial lung diseases (ILDs)
Singapore-based Enleofen to receive in excess of one billion USD per product in upfront and success-based development and commercialization milestones

https://www.enleofen.com/news/

There are many anti-IL11 antibody products not only X203 https://www.biocompare.com/pfu/110447/soids/315927/Antibodies/IL11

20 posted on 07/23/2024 1:56:53 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 3 | View Replies]


Navigation: use the links below to view more comments.
first 1-2021-29 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
General/Chat
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson