Free Republic
Browse · Search
General/Chat
Topics · Post Article

To: Red Badger; SunkenCiv
From the article in Nature:
IL-11 is progressively upregulated across tissues with age, probably as an alarmin-type response to age-related pathogenic factors that include cytokines, proteotoxic stress, oxidative species and DNA damage, among others. We propose that the pleiotropic benefits seen with inhibition of IL-11 reflect its modulation of multiple ageing pathways (such as ERK, AMPK, mTOR and JAK–STAT3), as seen using polypharmacy in flies. IL-11 has not been extensively studied and was not previously thought to be important for ageing, however SNPs at the IL11 locus are associated with osteoarthritis and menopause, and IL-11 is linked with senescence and diseases that are common in older people.

Mouse mortality in old age is often cancer-related and our end-of-life autopsy data support the notion that inhibition of IL-11 significantly reduces age-related cancers. Of note, IL-11 is important for tumorigenesis and tumour immune evasion and clinical trials of anti-IL-11 in combination with immunotherapy to treat cancer are planned.

We show here that a pro-inflammatory cytokine can affect affect age-related decline and lifespan in a mammal. The relative contributions of canonical (JAK–STAT3) and non-canonical (MEK–ERK) IL-11 signalling, alone or in combination, for ageing phenotypes remain to be determined.

Inhibition of ERK or mTOR or activation of AMPK by trametinib, rapamycin or metformin, respectively, increase lifespan in model organisms and such drugs are advocated by some for use in humans. However, these agents have on- and off-target toxicities along with variable, and sometimes detrimental, effects on healthspan and inflammation12,13,35,49. Our data suggest that anti-IL-11 therapy, which has a reassuring safety profile and is currently in early-stage clinical trials for fibroinflammatory diseases, is a potentially translatable approach for extending human healthspan and lifespan.

Looks very interesting

X203 is develepoed by https://www.enleofen.com/ funded by Boehringer Ingelheim.
BI Partners with Enleofen to Develop First-in-Class Anti-IL-11 Therapies for a Range of Fibrotic Diseases
Acquisition of worldwide exclusive rights adds extensive anti-IL-11 platform to Boehringer Ingelheim pipeline portfolio
Boehringer Ingelheim aims to develop therapies for multiple fibrotic human disorders, including non-alcoholic steatohepatitis (NASH) and interstitial lung diseases (ILDs)
Singapore-based Enleofen to receive in excess of one billion USD per product in upfront and success-based development and commercialization milestones

https://www.enleofen.com/news/

There are many anti-IL11 antibody products not only X203 https://www.biocompare.com/pfu/110447/soids/315927/Antibodies/IL11

20 posted on 07/23/2024 1:56:53 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 3 | View Replies ]


To: AdmSmith

If this pans out, the wealthy elites will hog it all for themselves.........


21 posted on 07/23/2024 5:24:03 AM PDT by Red Badger (Homeless veterans camp in the streets while illegals are put up in 5 Star hotels....................)
[ Post Reply | Private Reply | To 20 | View Replies ]

To: AdmSmith

Thanks!


27 posted on 07/23/2024 2:45:34 PM PDT by SunkenCiv (Putin should skip ahead to where he kills himself in the bunker.)
[ Post Reply | Private Reply | To 20 | View Replies ]

Free Republic
Browse · Search
General/Chat
Topics · Post Article


FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson