Free Republic
Browse · Search
General/Chat
Topics · Post Article

Skip to comments.

200,000-year-old tools from Stone Age unearthed in Saudi Arabia
Gulf News ^ | January 01, 2021

Posted on 01/02/2021 1:22:26 AM PST by nickcarraway

These are unique and rare stone axes from the Stone Age

A Saudi scientific team from the Heritage Authority discovered stone tools used by the inhabitants of Assyrian civilization in the Paleolithic period that date back to 2,00,000 years. The Heritage Authority said in a press statement that the discovered stone tools from the Shuaib Al-Adgham area, located east of the Al-Qassim region, are stone axes from the Middle Paleolithic period.

These are unique and rare stone axes that were characterised by the high precision in manufacturing that these human groups used in their daily life. The abundance of stone tools discovered from this site indicated the numerical density of prehistoric communities that lived in this region. It is also a clear indication that the climatic conditions in the Arabian Peninsula were very suitable for these human groups as they benefited from the natural resources available therein, the Saudi Gazette reported.

The satellite images showed that the Shuaib Al-Adgham and other sites were connected with passages of rivers to confirm that humans used rivers to reach deep into the interior regions of the Arabian Peninsula in ancient times. According to the wide spatial distribution of the Assyrian sites, they were the largest concentrations of human inhabitance worldwide. It also indicates that human groups in the Arabian Peninsula were able to cross through vast swathes of geographical distances, while the large number of sites centered around ancient valleys and rivers indicated that these groups were gradually spreading and discovering new sites when they needed them. These sites were characterised by the spread of broken stone fragments and manufactured tools.

The authority stated that a huge amount of new environmental and cultural information has been collected, and the results showed that there were significant changes in the environments, ranging from very arid to humid. The current evidence strongly supports the assertions of the existence of the "Green Arabian Peninsula" many times in the past.

During the wet phases of human civilizations, there were rivers and lakes throughout the Arabian Peninsula, which led to the spread and expansion of these human groups. This confirms that the Arabian Peninsula was a major crossroads between Africa and the rest of Asia throughout prehistoric times and that it was one of the places of settlement in the period of the Stone Ages. It is believed that the ancient migrations of these human groups were through two main passages - the Bab Al-Mandab Strait and the Sinai Peninsula Corridor.


TOPICS: History; Science
KEYWORDS: alqassim; arabia; archaeology; babalmandab; godsgravesglyphs; middlepaleolithic; paleolithic; saudiarabia; shuaibaladgham; stoneage
Navigation: use the links below to view more comments.
first previous 1-2021-4041-44 next last
To: nickcarraway

I’ve got rocks and a bridge to sell thats old too.


21 posted on 01/02/2021 8:34:33 AM PST by aces (and )
[ Post Reply | Private Reply | To 1 | View Replies]

To: Alas Babylon!

depends on the stage of gene manipulation, aliens...lol


22 posted on 01/02/2021 8:36:20 AM PST by aces (and )
[ Post Reply | Private Reply | To 13 | View Replies]

To: sit-rep
lol... just why am I a bit skeptical looking at this handful of rocks...

Hey! When I was ten and playing army with my buds that clump of sod in my hand was a hand grenade despite what my mom said. Empirical evidence was on my side, the kid I threw it at collapsed DRT!

23 posted on 01/02/2021 8:46:51 AM PST by Covenantor (We are ruled...by liars who refuse them news, and by fools who can not govern. " Chesterton)
[ Post Reply | Private Reply | To 3 | View Replies]

To: Covenantor

lol...


24 posted on 01/02/2021 9:29:17 AM PST by sit-rep ( )
[ Post Reply | Private Reply | To 23 | View Replies]

To: Vermont Lt
I think that humans showing up 12,000 years ago is a little naive.

So do I - obviously the human race is far older than 12,000 years. But human civilization - agriculture, the building of the first cities, the first writings - that's a lot more recent.
25 posted on 01/02/2021 10:03:05 AM PST by AnotherUnixGeek
[ Post Reply | Private Reply | To 17 | View Replies]

To: Vermont Lt

“I think that humans showing up 12,000 years ago is a little naive. But I don’t “know”.”

There’s digs in Turkey that are dated at 12,000 years, Gobekli Tepe: The World’s First Temple.

https://www.smithsonianmag.com/history/gobekli-tepe-the-worlds-first-temple-83613665/


26 posted on 01/02/2021 2:27:53 PM PST by stockpirate (Hunter Biden didn't commit suicide, but Faux News did.)
[ Post Reply | Private Reply | To 17 | View Replies]

To: nickcarraway

[snip] stone tools used by the inhabitants of Assyrian civilization in the Paleolithic period that date back to 2,00,000 years [/snip] — clearly there’s a translation issue, or the original source was incompetent. :^) Thanks nickcarraway.


27 posted on 01/02/2021 11:34:13 PM PST by SunkenCiv (Imagine an imaginary menagerie manager imagining managing an imaginary menagerie.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: antidemoncrat

Did the Queens use them?


28 posted on 01/02/2021 11:36:35 PM PST by dfwgator (Endut! Hoch Hech!)
[ Post Reply | Private Reply | To 18 | View Replies]


29 posted on 01/03/2021 12:16:13 AM PST by SunkenCiv (Imagine an imaginary menagerie manager imagining managing an imaginary menagerie.)
[ Post Reply | Private Reply | View Replies]

To: StayAt HomeMother; Ernest_at_the_Beach; 1ofmanyfree; 21twelve; 24Karet; 2ndDivisionVet; 31R1O; ...
Thanks nickcarraway. This will have to serve as the weekly ping as well.

30 posted on 01/03/2021 12:22:22 AM PST by SunkenCiv (Imagine an imaginary menagerie manager imagining managing an imaginary menagerie.)
[ Post Reply | Private Reply | View Replies]

To: SunkenCiv

Remarkable. All these years later and they are still in the stone age.


31 posted on 01/03/2021 12:48:45 AM PST by colorado tanker
[ Post Reply | Private Reply | To 30 | View Replies]

To: nickcarraway; sit-rep; SunkenCiv; AnotherUnixGeek; Varda; nuconvert; Alas Babylon!; pangaea6; ...
In the article: used by the inhabitants of Assyrian civilization in the Paleolithic period that date back to 2,00,000 years.

but why stop at that age: According to the Saudi Heritage Authority, rare stone tools from the Middle Ages have been found in the Shuaib al-Adgam area of ​​Saudi Arabia. It can be inferred from this that the aborigines of the day made axes and other tools out of stone. Officials say these were made over 2 million years ago.
https://primetimezone.com/trending/excavations-stone-age-landmarks-unearthed/

Is it 20 000 years ago?

32 posted on 01/03/2021 1:07:43 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 1 | View Replies]

To: AdmSmith

I guess a typo and are missing a zero


33 posted on 01/03/2021 5:04:51 AM PST by nuconvert ( Warning: Accused of being a radical militarist. Approach with caution.)
[ Post Reply | Private Reply | To 32 | View Replies]

To: Does so
“humans used rivers to reach deep into the interior regions of the Arabian Peninsula in ancient times”...

It’s always smart to live upstream. ;-)

Today Saudi Arabia has no rivers whatsoever.

34 posted on 01/03/2021 7:17:12 AM PST by null and void (When the press doesn’t report something, it’s because the narrative would reflect badly on the Left)
[ Post Reply | Private Reply | To 6 | View Replies]

To: nickcarraway

And the culture there hasn’t advanced since.


35 posted on 01/03/2021 9:21:13 AM PST by Grimmy (equivocation is but the first step along the road to capitulation)
[ Post Reply | Private Reply | To 1 | View Replies]

To: sit-rep; nickcarraway; SunkenCiv; Dusty Road; trebb
"lol... just why am I a bit skeptical looking at this handful of rocks..."

~~~~~~~~~~~
Probably because you have no idea what you're looking at...
~~~~~~~~~~~

Although the photo is lousy, anyone who has experience in successfully replicating stone tools can readily see evidence of planned and controlled bilateral, multiple flake removals on some of the specimens. That simply does not occur by any natural ("geofact") process.

There are three specimens in the photo that show repeated, adjoining flake removals -- positioned to create a sharp cutting edge on one lateral side. All flake removals were made by "hard-hammer percussion" (hitting near an edge with another rock ["hammerstone"] -- specifically to remove flakes from the opposite face of the piece).

The specimen at right, near the top of the 10-cm scale stick, has almost a dozen such carefully-placed "flake scars" along its right edge alone. Given the grainy toughness of that stone material, I'm not sure I could do much better with the same piece of rock.

There is zero question that the mind-eye-hand feedback loop of a human being produced some of the pictured specimens.

As to their actual age, deponent sayeth naught... '-)

TXnMA   

Texas Archæological Steward, lithic technologist, flintknapper...

36 posted on 01/03/2021 12:43:49 PM PST by TXnMA (The Democrat Party has a single-element strategy: CHEATING... Reinstate Public Executions!)
[ Post Reply | Private Reply | To 3 | View Replies]

To: TXnMA

Narcissist much?? smdh...

You can always depend on FR to have its share of Mr. and Mrs. Wonderful...

Once you get past your own self, you may have noticed the Jest in my tone. but I doubt it. And I dont give af who you are, but I see rocks like this almost every day in the construction industry. chips and all!! If you dont like guys like me raining on your parade for rocks, post better fkng pictures...


37 posted on 01/03/2021 2:44:53 PM PST by sit-rep ( )
[ Post Reply | Private Reply | To 36 | View Replies]

To: TXnMA

Here ya go man... pay close attention around 2:30 on...

https://www.youtube.com/watch?v=J8QEvDInevE


38 posted on 01/03/2021 2:55:24 PM PST by sit-rep ( )
[ Post Reply | Private Reply | To 36 | View Replies]

To: sit-rep; TXnMA
You can always depend on FR to have its share of Mr. and Mrs. Wonderful...

FR depends on experts, so it's especially productive having them aboard!

39 posted on 01/03/2021 3:37:11 PM PST by Does so (We failed to call them Communists...)
[ Post Reply | Private Reply | To 38 | View Replies]

To: Does so
lol... (...What is that strange sound in the distance?...)

Experts are one thing... Narcissists are something else. Know the difference before embarrass yourself...

40 posted on 01/03/2021 4:02:41 PM PST by sit-rep ( )
[ Post Reply | Private Reply | To 39 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-2021-4041-44 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
General/Chat
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson