Free Republic
Browse · Search
General/Chat
Topics · Post Article

Skip to comments.

Johor to Test if Human-Looking Goat Is Offspring of Human and Animal
Asia One ^

Posted on 05/10/2016 10:59:44 PM PDT by nickcarraway

It will take around two weeks to a month to finalise the investigations on the carcass of a kid in Kota Tinggi that was said to resemble a human infant (pic).

Johor state Agriculture and Agro-based Industry committee chairman Ismail Moha­med said then they would be able to find out the possibility of an offspring produced by a human and an animal.

"For now we cannot confirm or deny anything as we have never received such a case before.

"We will have to wait for the results and findings to be finalised and that takes somewhere between two weeks and a month," he told The Star yesterday.

He said instructions had been given out to the Kota Tinggi district veterinary services office to hand over the carcass of the kid to the state Veterinary Services Department la­­boratory for tests to be conducted.

He said research would be conducted on the kid's carcass to find out the reasons behind its human-looking features.

This included investigating the possibility that the mother goat was violated by a human, he said.

It was reported that Ibrahim Basir of Felda Sungai Mas was shocked to find that one of the goats had given birth to a baby goat with a face, nose, short legs and soft body that resembled that of a human infant but was dead upon discovery.

Despite the humanly features, the kid reportedly did not have any umbilical cord and Ibrahim even turned down offers to buy the carcass and instead reported the case to the veterinary authorities.

Ismail advised the public not to speculate on the reasons behind the strange-looking kid's appearance and wait for the matter to be concluded.


TOPICS: Local News; Pets/Animals; Science
KEYWORDS: cryptobiology; dna; goat; godsgravesglyphs; goldenhair; grump; helixmakemineadouble; hellebore; human; islam; kotatinggi; malaysia
Navigation: use the links below to view more comments.
first previous 1-2021-4041 next last
To: fluorescence

That reminds me.

Q: How does a Muslim find a goat lost in the bushes?

A: very satisfying


21 posted on 05/11/2016 2:56:57 AM PDT by MeanWestTexan (Sometimes There Is No Lesser Of Two Evils)
[ Post Reply | Private Reply | To 8 | View Replies]

To: nickcarraway

“Johor to Test if Human-Looking Goat Is Offspring of Human and Animal”

No testing is necessary. Stupid muslims should open a freaking biology book.


22 posted on 05/11/2016 3:19:25 AM PDT by Brooklyn Attitude (It's the apocalypse, lets have some fun!)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Jeff Chandler

and the goat,...it lies. /s

Animals are of one flesh and man another.

It is more likely the goat was molested by a satyr.


23 posted on 05/11/2016 3:25:05 AM PDT by Cvengr ( Adversity in life & death is inevitable; Stress is optional through faith in Christ.)
[ Post Reply | Private Reply | To 14 | View Replies]

To: Brooklyn Attitude

“Hey Ted, let’s get that knarley old goat dude over there!” - Bill S. Preston, Esquire


24 posted on 05/11/2016 3:31:09 AM PDT by MikeSteelBe (Barackolypse How?)
[ Post Reply | Private Reply | To 22 | View Replies]

To: nickcarraway

Baaaaaaaaaaaa-lahu Aaaaaaaaackbar.


25 posted on 05/11/2016 3:35:17 AM PDT by 60Gunner (The price of apathy towards public affairs is to be ruled by evil men. - Plato)
[ Post Reply | Private Reply | To 1 | View Replies]

To: nickcarraway

So who do you honor kill? The goat or the human?


26 posted on 05/11/2016 4:48:46 AM PDT by DannyTN
[ Post Reply | Private Reply | To 1 | View Replies]

To: nickcarraway

The Orson Wells movie “The island of Moriow” (the name ecsapes me) comes to mind...


27 posted on 05/11/2016 4:55:41 AM PDT by Popman (Christ alone: My Cornerstone...)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Popman

Do you mean the H.G. Wells book (later movie) “The Island of Dr. Moreau”?


28 posted on 05/11/2016 4:57:37 AM PDT by Dr. Sivana ("There is no limit to the amount of good you can do if you don't care who gets the credit."-R.Reagan)
[ Post Reply | Private Reply | To 27 | View Replies]

To: nickcarraway

Whatever it is isn’t Halal.


29 posted on 05/11/2016 4:58:41 AM PDT by Dr. Sivana ("There is no limit to the amount of good you can do if you don't care who gets the credit."-R.Reagan)
[ Post Reply | Private Reply | To 1 | View Replies]

To: fluorescence

That was the first thing that popped into my mind.


30 posted on 05/11/2016 4:59:28 AM PDT by MayflowerMadam (Trump loves America and will protect the people who live here first, last and always. - Coulter)
[ Post Reply | Private Reply | To 8 | View Replies]

To: Dr. Sivana

Yes...thank you.
.


31 posted on 05/11/2016 5:02:31 AM PDT by Popman (Christ alone: My Cornerstone...)
[ Post Reply | Private Reply | To 28 | View Replies]

To: nickcarraway
This included investigating the possibility that the mother goat was violated by a human, he said.

Whoa! Hey Now, who are you to judge and impose your views of morality on this loving couple? You're just prejudiced against interspecies love and trying to shove your outdated religious beliefs down their throats. What two consenting mammals do within a loving relationship is none of your concern, they should have the same rights, including the right to marry as any other couple. /sarcasm (but I wouldn't put it past a liberal to actually make that argument)

32 posted on 05/11/2016 5:56:07 AM PDT by apillar
[ Post Reply | Private Reply | To 1 | View Replies]

To: Wilderness Conservative
This reminds me of one of Johnny Carson's funniest Karnak moments.

During the Iranian Hostage Crisis in 1980, Iranian Foreign Minister Sadegh Ghotbzadeh (usually pronounced goats-buh-day) was a well-known figure involved in the negotiations for the release of the American hostages.

Karnak: (holds envelope to head) Ghotbzadeh.

Ed: Ghotbzadeh.

Karnak: (opens envelope and reads contents) What does an Iranian do when his wife withholds sex by night.

It took a moment for the audience to get the joke, but when they did it was one of the longest laughs I'd ever heard on the Tonight Show!

33 posted on 05/11/2016 6:27:04 AM PDT by Corpus_Delicious
[ Post Reply | Private Reply | To 12 | View Replies]

To: Daffynition

yuk


34 posted on 05/11/2016 11:19:44 AM PDT by goat granny
[ Post Reply | Private Reply | To 17 | View Replies]

To: StayAt HomeMother; Ernest_at_the_Beach; decimon; 1010RD; 21twelve; 24Karet; 2ndDivisionVet; ...
This is a three-header topic, in the parlance of the old-style GGG Digest -- Cryptobiology, Oh So Mysteriouso, and Helix, Make Mine a Double.

35 posted on 05/11/2016 11:58:57 AM PDT by SunkenCiv (Here's to the day the forensics people scrape what's left of Putin off the ceiling of his limo.)
[ Post Reply | Private Reply | View Replies]

To: nickcarraway

That is impossible, not even compatible number of chromosomes 69 vs 46 https://en.wikipedia.org/wiki/List_of_organisms_by_chromosome_count (among other things)


36 posted on 05/11/2016 12:20:06 PM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 1 | View Replies]

sorry should be 60 vs 46


37 posted on 05/11/2016 12:21:06 PM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 36 | View Replies]

To: To Hell With Poverty

38 posted on 05/11/2016 12:27:56 PM PDT by BenLurkin (The above is not a statement of fact. It is either satire or opinion. Or both.)
[ Post Reply | Private Reply | To 5 | View Replies]

To: nickcarraway

So just WAS Ibrahim Basir of Felda Sungai Mas doing around the goat pen in the middle of the night?


39 posted on 05/11/2016 12:39:14 PM PDT by Alas Babylon!
[ Post Reply | Private Reply | To 1 | View Replies]

To: BenLurkin

What the nanny goat saw when she turned around...

Well now we know the one thing that temporarily quells Islamic rage!


40 posted on 05/11/2016 9:15:32 PM PDT by To Hell With Poverty (Those who make peaceful revolution impossible will make violent revolution inevitable. ~ JFK ~)
[ Post Reply | Private Reply | To 38 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-2021-4041 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
General/Chat
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson