Free Republic
Browse · Search
General/Chat
Topics · Post Article

Skip to comments.

Earth 'to get second sun this year' as supernova turns night into day (well, maybe)
Daily Mail ^ | 1/21/11 | David Gardner

Posted on 01/21/2011 1:20:10 PM PST by markomalley

The Earth could soon have a second sun, at least for a week or two.

The cosmic phenomenon will happen when one of the brightest stars in the night sky explodes into a supernova.

And, according to a report yesterday, the most stunning light show in the planet’s history could happen as soon as this year.

Earth will undoubtedly have a front row seat when the dying red supergiant star Betelgeuse finally blows itself into oblivion.

The explosion will be so bright that even though the star in the Orion constellation is 640 light-years away, it will still turn night into day and appear like there are two suns in the sky for a few weeks.

The only real debate is over exactly when it will happen.

In stellar terms, Betelgeuse is predicted to crash and burn in the very near future. But that doesn’t necessarily mean you have to rush out and buy sunglasses.

Brad Carter, Senior Lecturer of Physics at the University of Southern Queensland in Australia, claimed yesterday that the galactic blast could happen before 2012 – or any time over the next million years.

(Excerpt) Read more at dailymail.co.uk ...


TOPICS: Astronomy; Science
KEYWORDS: astronomy; australia; betelgeuse; catastrophism; orion; stringtheory; xplanets
Navigation: use the links below to view more comments.
first previous 1-20 ... 81-100101-120121-140141-144 next last
To: markomalley
The cosmic phenomenon will happen when one of the brightest stars in the night sky explodes into a supernova.

Sweet!


121 posted on 01/21/2011 9:10:42 PM PST by Texas Eagle (If it wasn't for double-standards, Liberals would have no standards at all -- Texas Eagle)
[ Post Reply | Private Reply | To 1 | View Replies]

To: SunkenCiv; onyx; Jim Robinson
Bigheadfred 'wins the lottery' as my lucky stars turns night into day (well, maybe)
Just My Luck | 1/21/11 bigheadfred


FR is funded solely by donations from our readers.
Help keep FR strong, commercial ad & pop-up-free, and beholden to no outsiders!
Make your donation today by secure server (make it a monthly if you can).
Or by mail to: Free Republic, LLC, PO Box 9771, Fresno, CA 93794
Skip to comments.
[ Report Abuse | Bookmark ]

Navigation: use the links below to view more comments.
first previous 1-5051-100101-121 last
To: sunkenciv

What else with the snow falling?

teehee posted on 01/21/2011 4:49:33 PM PST by bigheadfred

Freeploaders click here

122 posted on 01/21/2011 11:04:05 PM PST by bigheadfred (As a rapturous voice escapes I will tremble a prayer and I'll ask for forgiveness)
[ Post Reply | Private Reply | To 106 | View Replies]

To: gcraig

Hoaxland? Really?


123 posted on 01/21/2011 11:41:59 PM PST by PeaceBeWithYou (De Oppresso Liber! (50 million and counting in Afghanistan and Iraq))
[ Post Reply | Private Reply | To 110 | View Replies]

To: dragnet2

Thanks for your nice pictures.


124 posted on 01/22/2011 12:46:24 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 120 | View Replies]

To: AdmSmith
You're welcome and I appreciate the comment.

Its fun to go after objects like those and try to capture them. The digital technology really opened it up for those like me that operate small instruments and Canon cameras. It keeps my out of trouble too.

125 posted on 01/22/2011 6:47:36 AM PST by dragnet2 (Diversion and evasion are tools of deceit)
[ Post Reply | Private Reply | To 124 | View Replies]

To: bigheadfred

:’)


126 posted on 01/22/2011 7:27:08 AM PST by SunkenCiv (The 2nd Amendment follows right behind the 1st because some people are hard of hearing.)
[ Post Reply | Private Reply | To 122 | View Replies]

To: dragnet2

What gear do you use to target different parts of the sky?


127 posted on 01/22/2011 11:20:15 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 125 | View Replies]

To: AdmSmith
An old 10" Schmidt Cassegrain telescope, with a Canon 40D in the optical train...All mounted to an equatorial wedge. I have some light pollution which washes out the sky, but use light filters to help eliminate those wave lengths that cause sky glare. The sky glare caused by things like street lights can destroy images, and the view of the night sky for that matter.

The scope has tracking motors that follow the object I want to shoot, so long term exposures can be obtained. The more light that "burns" or collects onto the camera sensor the better. These objects are not visible to the unaided eye where I live, so the longer I can track them and expose them to the sensor/chip, the better. Bottom line is digital has allowed me to take say 50, 150second exposures and stack them together in software and combine them into one image. Old film required tracking objects for one hour or more....Now I take a bunch of 150second exposures and stack them together. .

This all helps eliminate the need for critical tracking of objects for an hour or so like one needed to do in the old film days, which can be extremely difficult to do. We still have to track the objects, but with much less tracking time, eliminating many of the errors which can cause streaks and blurring of the images.

128 posted on 01/22/2011 12:52:24 PM PST by dragnet2 (Diversion and evasion are tools of deceit)
[ Post Reply | Private Reply | To 127 | View Replies]

To: Hot Tabasco

‘zactly what I was thinkin’!


129 posted on 01/22/2011 2:00:27 PM PST by brytlea
[ Post Reply | Private Reply | To 6 | View Replies]

To: dragnet2

Cool, I hope that you will post some more pictures.


130 posted on 01/22/2011 2:25:47 PM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 128 | View Replies]

To: Tublecane

>> “The sun isn’t an especially bright star; it’s the star around which our planet revolves” <<

.
Is there another one that gives us more light?

Stupid comment, huh?


131 posted on 01/22/2011 2:35:04 PM PST by editor-surveyor (NOBAMA - 2012)
[ Post Reply | Private Reply | To 15 | View Replies]

To: AdmSmith
Here's a pic of my scope that took the shots above. You can see the Canon camera at the left side center/top.

You might notice the 2 bolt/adjustable steel 1/2" plates, I salvage from the local junk yard. Everything is mounted to my junk yard steel plates...lol

I'll put up another pic when I get time...Got some issues going around the hideout right now...

132 posted on 01/22/2011 2:52:53 PM PST by dragnet2 (Diversion and evasion are tools of deceit)
[ Post Reply | Private Reply | To 130 | View Replies]

To: The Theophilus

>>Let me emphasize “Dysfunction” because not only is the Scripture wresting awful, but the science behind that statement sounds like something the notable scientist and intellectual Sheila Jackson Lee or Rosie O’donnell would say.

Thanks for the thoughtful scientific arguments to the contrary that convinces me that you’re correct. You really knew how to stick it to me!


133 posted on 01/22/2011 6:32:41 PM PST by struggle ((The struggle continues))
[ Post Reply | Private Reply | To 115 | View Replies]

To: RegulatorCountry

>>A supernova would control or obscure the sun and moon just how?

>>If it were as bright as the sun, that wouldn’t diminish the brightness of the sun but compete with it. If it were brighter than the moon, it wouldn’t do so by dimming the moon, it would merely be brighter by comparison.

>>If a supernova were close enough to somehow obscure the sun and moon, we wouldn’t be discussing this on FR, we’d all be dead.

Well the quote is “sackcloth of goathair” whatever that means. I used to ponder it and thought that it might be a monstrous volcanic eruption or meteorite collision, but then the sun AND the moon would be obscured.

But then again, we’ve never seen a massive supernova in our celestial neighborhood. The moon would definitely take on a red tint. What the sun looks like, who knows?


134 posted on 01/22/2011 6:38:42 PM PST by struggle ((The struggle continues))
[ Post Reply | Private Reply | To 118 | View Replies]

To: Tublecane
I don’t get how that is supposed to be a “second sun.”

What they mean to say is that the supernova as we perceive it on Earth will as bright as we perceive the sun to be. You'll be able to sit by the pool at 2 AM and work on your tan.

135 posted on 01/22/2011 6:51:18 PM PST by SFConservative
[ Post Reply | Private Reply | To 15 | View Replies]

To: struggle
Thanks for the thoughtful scientific arguments to the contrary

So those who make the ludicrous claims are exempt from substantiating their statements, yet those who ask "Really?" are required to do your homework for you.

First off, you were shown in Scripture that your claims are bogus because adding a supernova doesn't blot out our sun Light + Light doesn't equal "dark as sackcloth" unless you are living in a parallel universe with its own set of physics. Second, it apocalyptic language which only the illiterate and gullible would try to understand literally.

Third, you provided nothing more than a claim that a red-giant going super nova would cause the moon to turn to blood (let alone get a red tint). Our perception of the moon's color is dependent on the atmosphere between us and the moon. Another way that the moon could appear reddish is by bending light such as when the earth gets between the moon and sun (aka total lunar eclipse) and the light from the sun is bent by earth's gravitational field, combined with leakage of light through the Earth's atmosphere giving the reflector moon a reddish tint (but not "as blood") This is an observable and repeatable phenomena.

Your claims have never been observed, can't be repeated and are purely speculative based on no known science. That makes it superstition and fable. Since the moon is a reflector, it will reflect the light that is cast upon it. From our point of observation, the supernova would have to compete with our sun and outshine it with a very deep color red, which even a red giant going nova will not do.

Fourth, it wasn't until a few years ago that scientists could even figure out how large Betelgeuse was, let alone have any idea how far it is from Earth. To this day, they can't say with any certainty that Betelgeuse is 500 or even 800 light years away since the margin of error in their best estimations is 150 light years! And according to scientists, they have no idea when it can go supernova, it could be a few years from now it can be a million years from now. That is a rather significant margin of error.

I can imagine how this went down, the journalist was interviewing a cosmologist about something and Betelgeuse came up. The scientists was probably rattling on about parsecs and angstroms, light shift and neutrinos and the liberal arts major's eyes glazed over until the scientists, after discussing a super giant's iron core, probably said somewhere that "someday it will collapse". About this time, the journalist, searching for something interesting to write an article about, heard that statement and asked the inevitable question - "Really? What would happen?" whereupon he then heard "Real Big Explosion". Being a trained journalist, he then followed up on the "What" with the "When" and heard "It could be between one year and a million years." because the cosmologist was trying to express a "No one knows" sort of answer and didn't want to actually say "No one knows" because scientists don't want to appear ignorant unless they are hussling up money for a grant.

So the journalist now has a story, he shamelessly cuts and pastes whole paragraphs from wikipedia, throws in "next year", the editor makes a headline out of it, and then Dysfunctionalists who scour the newspapers looking for any reason to scream "JESUS IS COMING" stumble across this, tie it to the Mayans getting bored and not stringing out their calendar for a few more centuries, and concludes that the earth is doomed and Jesus is coming back in 2012.

Then you go ahead and bastardize a passage in Scripture to feed this lunacy and then people like me who are tired of nominal Christians embarrassing us with this insipid date setting jumps on you and begs that you stop.

That is how we got here.

136 posted on 01/22/2011 7:10:46 PM PST by The Theophilus
[ Post Reply | Private Reply | To 133 | View Replies]

To: struggle

The moon can take on a red tint due to thick smoke in the air. It does take on a red tint during a lunar eclipse. Sackcloth of whatever material is coarse and not tightly knit, so some light can pass through, but not a lot. A supernova would not change the color of the moon, although it might make it difficult to see due to the competing light. it wouldn’t darken the sun either, it would compete with it.


137 posted on 01/22/2011 7:48:49 PM PST by RegulatorCountry
[ Post Reply | Private Reply | To 134 | View Replies]

To: AdmSmith
Shot this image last year

Orion Nebula M-42, about 1275- Light years from earth.

M42 Orion is a stellar nursery where over 700 stars at various stages are being formed within the central core of the nebula.

Prime focus, SCT10"-19x65second, raw format, ISO800, aligned, calibrated and stacked in DSS, 6.3 focal reducer, CLS-LP filters,w/Canon 40D.

138 posted on 01/22/2011 8:52:24 PM PST by dragnet2 (Diversion and evasion are tools of deceit)
[ Post Reply | Private Reply | To 130 | View Replies]

To: The Theophilus

>>First off, you were shown in Scripture that your claims are bogus because adding a supernova doesn’t blot out our sun Light + Light doesn’t equal “dark as sackcloth” unless you are living in a parallel universe with its own set of physics. Second, it apocalyptic language which only the illiterate and gullible would try to understand literally.

So, you’re insulting me “it” instead of arguing.

>>Third, you provided nothing more than a claim that a red-giant going super nova would cause the moon to turn to blood (let alone get a red tint). Our perception of the moon’s color is dependent on the atmosphere between us and the moon. Another way that the moon could appear reddish is by bending light such as when the earth gets between the moon and sun (aka total lunar eclipse) and the light from the sun is bent by earth’s gravitational field, combined with leakage of light through the Earth’s atmosphere giving the reflector moon a reddish tint (but not “as blood”) This is an observable and repeatable phenomena.

Ok, so every lunar eclipse is the apocalypse.

>>Your claims have never been observed, can’t be repeated and are purely speculative based on no known science. That makes it superstition and fable.

Same as evolution through mutation to more beneficial genes or into a new species. Wow, thanks.

>>Then you go ahead and bastardize a passage in Scripture to feed this lunacy and then people like me who are tired of nominal Christians embarrassing us with this insipid date setting jumps on you and begs that you stop.

And again I say “it reminds of this verse.” So what’s your point? It reminded me of a verse. Your argument still seems to be a senseless attack against a quoting of a verse that really may or may not have any relation to the supernova of Betelgeuse.

Brew some tea. Sit back. Relax.


139 posted on 01/22/2011 9:08:26 PM PST by struggle ((The struggle continues))
[ Post Reply | Private Reply | To 136 | View Replies]

To: rdl6989

:’)

http://www.freerepublic.com/focus/bloggers/2661523/posts
http://www.freerepublic.com/focus/news/2661736/posts


140 posted on 01/23/2011 6:51:23 AM PST by SunkenCiv (The 2nd Amendment follows right behind the 1st because some people are hard of hearing.)
[ Post Reply | Private Reply | To 107 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 81-100101-120121-140141-144 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
General/Chat
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson