Free Republic
Browse · Search
General/Chat
Topics · Post Article

Skip to comments.

Wallabies and Bats Harbor "Fossil" Genes from the Most Deadly Family of Human Viruses
State University of New York, Buffalo ^ | June 28, 2010 | Unknown

Posted on 07/05/2010 5:25:21 PM PDT by decimon

Research reveals potential reservoir species, new mechanism for how mammals acquire genes

BUFFALO, N.Y. -- Modern marsupials may be popular animals at the zoo and in children's books, but new findings by University at Buffalo biologists reveal that they harbor a "fossil" copy of a gene that codes for filoviruses, which cause Ebola and Marburg hemorrhagic fevers and are the most lethal viruses known to humans.

Published this week in the online journal BMC Evolutionary Biology, the paper ("Filoviruses are ancient and integrated into mammalian genomes") demonstrates for the first time that mammals have harbored filoviruses for at least tens of millions of years, in contrast to the existing estimate of a few thousand.

It suggests that these species, which maintain a filovirus infection without negative health consequences, could have selectively maintained these so-called "fossil" genes as a genetic defense.

The work has important implications for the development of potential human vaccines, as well as for the modeling of disease outbreaks and the discovery of emerging diseases, including new filoviruses.

(Excerpt) Read more at buffalo.edu ...


TOPICS: Health/Medicine; History; Science
KEYWORDS: godsgravesglyphs; helixmakemineadouble; paleontology

1 posted on 07/05/2010 5:25:26 PM PDT by decimon
[ Post Reply | Private Reply | View Replies]

To: neverdem; DvdMom; grey_whiskers; SunkenCiv

First in, last out ping.


2 posted on 07/05/2010 5:26:39 PM PDT by decimon
[ Post Reply | Private Reply | To 1 | View Replies]

To: SunkenCiv

pingling


3 posted on 07/05/2010 6:48:35 PM PDT by tutstar (Baptist Ping List-freepmail me to be included or removed. <{{{><)
[ Post Reply | Private Reply | To 1 | View Replies]

To: decimon
Holy bat guano, are they saying we could catch a hemorrhagic virus from these critters? Guess its time to put Rocko down!
4 posted on 07/05/2010 7:10:03 PM PDT by nomad
[ Post Reply | Private Reply | To 1 | View Replies]

To: decimon; StayAt HomeMother; Ernest_at_the_Beach; 1ofmanyfree; 21twelve; 240B; 24Karet; ...

· join list or digest · view topics · view or post blog · bookmark · post a topic · subscribe ·

 
Gods
Graves
Glyphs
Thanks decimon!
Modern marsupials may be popular animals at the zoo and in children's books, but new findings by University at Buffalo biologists reveal that they harbor a "fossil" copy of a gene that codes for filoviruses, which cause Ebola and Marburg hemorrhagic fevers and are the most lethal viruses known to humans... demonstrates for the first time that mammals have harbored filoviruses for at least tens of millions of years, in contrast to the existing estimate of a few thousand. It suggests that these species, which maintain a filovirus infection without negative health consequences, could have selectively maintained these so-called "fossil" genes as a genetic defense.
Gosh, it's been ages since:
The Scars of Evolution:
What Our Bodies Tell Us
About Human Origins

by Elaine Morgan
"The most remarkable aspect of Todaro's discovery emerged when he examined Homo Sapiens for the 'baboon marker'. It was not there... Todaro drew one firm conclusion. 'The ancestors of man did not develop in a geographical area where they would have been in contact with the baboon. I would argue that the data we are presenting imply a non-African origin of man millions of years ago.'"
To all -- please ping me to other topics which are appropriate for the GGG list.
GGG managers are SunkenCiv, StayAt HomeMother, and Ernest_at_the_Beach
 

·Dogpile · Archaeologica · Mirabilis.ca · LiveScience · Biblical Archaeology Society ·
· Discover · Nat Geographic · Texas AM Anthro News · Yahoo Anthro & Archaeo · Google ·
· Archaeology · The Archaeology Channel · Excerpt, or Link only? · cgk's list of ping lists ·


5 posted on 07/05/2010 7:34:00 PM PDT by SunkenCiv ("Fools learn from experience. I prefer to learn from the experience of others." -- Otto von Bismarck)
[ Post Reply | Private Reply | View Replies]

To: tutstar
Whoops! And thanks tutstar!
S.C. Dodge

6 posted on 07/05/2010 7:37:38 PM PDT by SunkenCiv ("Fools learn from experience. I prefer to learn from the experience of others." -- Otto von Bismarck)
[ Post Reply | Private Reply | To 3 | View Replies]

To: SunkenCiv; decimon
it was never thought gene transfer could occur between non-retroviral RNA viruses and hosts," says Bruenn. "This paper shows that it does and it may prove to be a far more general phenomenon than is currently known."

OK, no more sex with wallabies, even though I always got a kick out of it. Having sex with bats always seemed, well, a little...

7 posted on 07/05/2010 8:35:48 PM PDT by bigheadfred
[ Post Reply | Private Reply | To 6 | View Replies]

To: bigheadfred

...batty?


8 posted on 07/05/2010 9:13:00 PM PDT by null and void (We are now in day 528 of our national holiday from reality. - 0bama really isn't one of US.)
[ Post Reply | Private Reply | To 7 | View Replies]

To: bigheadfred

They’ve got that pouch, seems to me they’re just askin’ for it.


9 posted on 07/05/2010 9:28:24 PM PDT by SunkenCiv ("Fools learn from experience. I prefer to learn from the experience of others." -- Otto von Bismarck)
[ Post Reply | Private Reply | To 7 | View Replies]

To: decimon

About 8 % of the human genome is fossils of viruses. http://en.wikipedia.org/wiki/Endogenous_retrovirus


10 posted on 07/05/2010 10:52:08 PM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 1 | View Replies]

To: null and void

:-))


11 posted on 07/06/2010 8:31:52 AM PDT by bigheadfred
[ Post Reply | Private Reply | To 8 | View Replies]

To: SunkenCiv; All

Why would lack of the “baboon marker” mean that man did not evolve in Africa? Couldn’t it also mean that we and baboons split from our common ancestor before the baboon marker existed, and could have occurred in Africa?


12 posted on 07/06/2010 2:51:39 PM PDT by gleeaikin (question authority)
[ Post Reply | Private Reply | To 5 | View Replies]

To: gleeaikin

The idea there is, the split happened a while back, but the baboon virus arose much later. If our ancestors had been in contact with the baboon at the time the virus hit (and the same range is assigned to both the proto-baboon and all of them there Homos) then the viral marker would have made it through human DNA to the present. But it hasn’t. :’) Ergo, no African origin for our ancestors, and the Homo fossils are extinct lines. Since there are hardly any monkey ancestors in the fossil record, it’s not out of the question that the “Homo” fossils are really ancestral to the modern primates, rather than to us. (’:


13 posted on 07/06/2010 4:07:55 PM PDT by SunkenCiv ("Fools learn from experience. I prefer to learn from the experience of others." -- Otto von Bismarck)
[ Post Reply | Private Reply | To 12 | View Replies]

To: gleeaikin

Oh, and I should point out that Elaine Morgan regards the lack of the baboon viral marker in our chromosomes as supportive of her “aquatic ape” scenario, since she sez the ancestors of humans were isolated from other primates and whatall, east of the Great Rift.


14 posted on 07/06/2010 4:10:01 PM PDT by SunkenCiv ("Fools learn from experience. I prefer to learn from the experience of others." -- Otto von Bismarck)
[ Post Reply | Private Reply | To 12 | View Replies]

To: SunkenCiv

She called me an aquatic what???

15 posted on 07/07/2010 12:51:22 PM PDT by colorado tanker
[ Post Reply | Private Reply | To 14 | View Replies]

To: decimon

The Jonas Strain


16 posted on 07/07/2010 12:53:47 PM PDT by rintense
[ Post Reply | Private Reply | To 1 | View Replies]


17 posted on 07/31/2018 1:18:54 AM PDT by SunkenCiv (www.tapatalk.com/groups/godsgravesglyphs/, forum.darwincentral.org, www.gopbriefingroom.com)
[ Post Reply | Private Reply | To 5 | View Replies]

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
General/Chat
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson