Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

Skip to comments.

Attack On Europe: Documenting Russian Equipment Losses During The 2022 Russian Invasion Of Ukraine (2 year anniversary)
ORYX ^ | Since February 24, 2022 and daily | ORYX

Posted on 02/24/2024 5:59:01 AM PST by SpeedyInTexas

This list only includes destroyed vehicles and equipment of which photo or videographic evidence is available. Therefore, the amount of equipment destroyed is significantly higher than recorded here. Loitering munitions, drones used as unmanned bait, civilian vehicles and derelict equipment are not included in this list. All possible effort has gone into avoiding duplicate entries and discerning the status of equipment between captured or abandoned. Many of the entries listed as 'abandoned' will likely end up captured or destroyed. Similarly, some of the captured equipment might be destroyed if it can't be recovered. When a vehicle is captured and then lost in service with its new owners, it is only added as a loss of the original operator to avoid double listings. When the origin of a piece of equipment can't be established, it's not included in the list. The Soviet flag is used when the equipment in question was produced prior to 1991. This list is constantly updated as additional footage becomes available.

(Excerpt) Read more at oryxspioenkop.com ...


TOPICS: Military/Veterans
KEYWORDS: 0killthisthread; 1637borders; 3daywar; agitprop; alfredeblitz; americalast; angrykeywordtroll; anotherputinfail; anydaynowukrainewins; assistantdemsonfr; attackoneurope; beaubothebsartist; beauzo; bidenswar; bobomaximus; breevingroom; byepif; byespeedy; cantbreev; cheesymaximus; crazyivan; dailydeathfap; dailypropaganda; deadthread; deathcult; deepinthespamforest; delusionalzeepers; demyanganul; dimwit; dippythemelon; dualcitizenssuck; escalation; fishiemaximus; foreigntrolls; foreigntrollsonfr; formersovietofficers; freeploader; freeploadingspammer; gabbagabbahey; ghoulishdelight; gleefulnosegold; globohomo; goodriddance; hopium; irynazarutska; itsoveriwasright; jonboy; jonboyputinlover; keiththedimwit; kievstronk; liberalatpost7819; liedaboutleaving; melon; melonballsforever; melonlovesputin; melonlovesrussia; melonmemewarrior; melonmlrs; motherpif; muscovite; nato; omgputinputinputin; oyveygoyim; paidazovfans; paidazovtrolls; paidrussiantrolls; pancakemaximus; phdft; pifpouf; pifpuffs; planetzeep; polygamy; propagandareturns; put; putin; putinsfolly; putinstarted; putinswar; russia; russiandelusions; saintvolodymyr; siloviki; slaviccivilwar; slavictrolls; snufffilmsonfr; snufffilmtx; snuffpornforzeepers; snuffyfromtexas; spammyintexas; speedomaximus; speedycameback; speedyhadenough; speedyintroll; speedyisaliveandwell; speedyisdeadandfried; speedylied; stankazzintx; stankazztexicunt; staygonethistime; stenrynning; stinkstankstunkazz; stpetersburgtrolls; talkingtomypif; thisthreadisdead; tippecanoeandpiftoo; toldyouso; tothelastrussian; tothelastukrainian; ukraine; unhealthyobsession; usaidcheckbounced; usaidtrolls; vladtheimploder; warporn; wellbye; wildberry; yostanky; yurpstronk; zeepercirclejonk; zeepercreepers; zeeperdeathcult; zeeperhomeworld; zeeperloveazov; zeeperpr0n; zeepers; zeepersjustwannazeep; zeeperslovedeath; zeeperslovevindman; zeepersworshipdeath; zeepervictoryparade; zeepharder; zeeploaders; zeepyintexas; zipadeedoodah; zot; zottedintexas; zottyintexas
Navigation: use the links below to view more comments.
first previous 1-20 ... 15,201-15,22015,221-15,24015,241-15,260 ... 21,121-21,128 next last
To: PIF; blitz128
🍈

The illegal invasion is dangerous to Americans, not Putin


15,221 posted on 04/27/2025 5:58:13 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 15201 | View Replies]

To: FtrPilot

Reporting From Ukraine:
https://www.youtube.com/@RFU/videos

The complete transcript.

[ 1 Shot = 100 Targets! New British High-Frequency Weapon Wastes Years of Russian Drone Development ]

Today [ Apr 26, 8 pm ], there are a lot of interesting updates from Ukraine. Here, as Russian drone swarms grow larger and more complex, the UK has unveiled a weapon designed to stop them in their tracks in mass. Named the Rapid Destroyer, this new system, with battlefield testing on the horizon, may soon give Ukraine a game-changing tool to level the playing field.

Diplomatic relations between the United Kingdom and Ukraine are likely the best foreign relations Ukraine has with any European country, as the UK was the first country to provide military aid to Ukraine at the very start of the war.

Additionally, the current Ukrainian ambassador to the UK is Valeri Zaluzhny, the former chief of staff of the Ukrainian army, whose military expertise is critical for the continued improvement of military cooperation and exchange of intelligence between the two countries. Military technology between the UK and Ukraine is likely already being exchanged, with the British conducting tests with new laser weapons right before the same technology made an appearance in Ukraine.

Recently, the United Kingdom developed a weapon that could potentially neutralize the drone threat prevalent in Ukraine. This new electronic warfare system Rapid Destroyer can take out entire drone swarms in a single charge.

Unlike regular electronic warfare systems that only disrupt the connection to the operator and disorient the drones’ navigation systems, the new British system relies on high-frequency radio waves to disrupt and destroy the electronic components within the drones, causing them to malfunction and crash. The system can take out dozens of incoming drones at a time, making it highly suited to counteract large-scale Russian drone strikes.

In live trials, the system neutralized a swarm of 100 small quadcopters with near-instant effect. The Rapid Destroyer has demonstrated an effective engagement range of approximately 1 kilometer, with further development underway to extend its range and effectiveness.

An extended range would undoubtedly be needed to solidify its role as an effective system against drones in a layered air defense network. The UK Ministry of Defence highlighted the system’s low cost per engagement, estimated at just 10 cents per shot, making it a compelling alternative to missile-based or other hard-kill defenses that can cost thousands of dollars per use.

On top of that, the extensive targeting capability of Rapid Destroyer can simultaneously destroy and disable huge drone swarms with a single charge, only increasing its cost-effective nature. While production costs are unknown, the low operating cost would make Rapid Destroyer an extremely valuable asset if deployed in large numbers, which could offset the shorter range.

Lastly, the system is mounted on a flatbed truck, allowing for high mobility to quickly respond to incoming threats and withdraw before being targeted, though its substantial power requirements necessitate a robust energy source.

With the high likelihood of close cooperation and technology sharing between Ukraine and the UK, this system could significantly reinforce the Ukrainian air defense network, providing a powerful additional layer, even at shorter ranges.

During long-range strikes, Russians often attempt to target one point in Ukraine’s air defenses, to overload and exhaust Ukrainian capabilities, and allow subsequent strikes to get through. Rapid Destroyers could quickly and efficiently neutralize these initial drone swarms, allowing other Ukrainian air defense systems to preserve air missiles and ammunition to shoot down higher-threat Russian ballistic and cruise missiles.

Overall, there is a high likelihood that this technology will soon appear in Ukraine as well, as Ukrainian engineers will strive to develop and produce domestic variants of Rapid Destroyer on a large scale, if proven effective at countering Russian drones. Given Ukraine’s deep, hard-earned expertise in countering drone warfare, incorporating systems like the Rapid Destroyer into their arsenal could significantly enhance their defensive capabilities.

Furthermore, a key incentive for technology sharing between Western allies and Ukraine lies in the potential for real-world feedback. Ukrainian forces are already providing invaluable battlefield data and performance evaluations to Western allies, which are otherwise difficult to replicate in testing environments.

These kinds of practical insights will enable designers and engineers in the West to rapidly iterate and improve on their existing weapon systems, strengthening defense capabilities in Ukraine and across the whole of NATO, while reinforcing the collaborative nature of modern warfare technology and development.

https://www.youtube.com/watch?v=6vsSRcGcXAA


15,222 posted on 04/27/2025 5:58:17 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 15217 | View Replies]

To: PIF

A lot of effort to make it seem like motorcycle Calvary is planned and effective😂


15,223 posted on 04/27/2025 6:00:21 AM PDT by blitz128
[ Post Reply | Private Reply | To 15218 | View Replies]

To: blitz128
🤬 This is what "Russian World" looks like…

https://x.com/UkrReview/status/1916390419400622560


15,224 posted on 04/27/2025 6:11:00 AM PDT by FtrPilot
[ Post Reply | Private Reply | To 15223 | View Replies]

To: LowIQ
🍈

This is dangerous to Americans, not Putin


15,225 posted on 04/27/2025 6:11:20 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 15223 | View Replies]

To: BeauBo
Ukrainian factories are reportedly producing up to 36 2S22 Bohdana 155mm self-propelled artillery systems every month.

That figure represents a massive increase in Ukrainian defense production capabilities, making the Bohdana one of the most widely produced SPHs in the world.

https://x.com/Osinttechnical/status/1916289653038031139

Send more artillery!

15,226 posted on 04/27/2025 6:26:20 AM PDT by FtrPilot
[ Post Reply | Private Reply | To 15224 | View Replies]

To: PIF
Who was behind the attack in Kashmir?

23APR2025 In Pahalgam, Kashmir, tourists came under attack from gunmen 22APR2025 who emerged from a nearby forest. The men armed with automatic rifles shot at least 26 tourists dead and injured several others. All those killed were men. The Resistance Front (TRF), a little-known armed group that emerged in the region in 2019, claimed responsibility for the attack.

The name The Resistance Front is a break from traditional rebel groups in Kashmir, most of which bear Islamic names. This, Indian intelligence agencies believe, was aimed at projecting “a neutral character, with ‘resistance’ in name focused on Kashmiri nationalism”, said a police officer, who has worked on cases involving armed groups for nearly a decade, requesting anonymity.

However, Indian officials have consistently maintained that, in reality, TRF is an offshoot — or just a front — of the Lashkar-e-Taiba, a Pakistan-based armed group. India says Pakistan supports the armed rebellion in Kashmir, a charge denied by Islamabad. Pakistan says it provides only diplomatic and moral support to the Kashmiri people. It also condemned the attack on tourists in Pahalgam. Some Indian officials said they believe Tuesday's attack may actually have been the handiwork of the Lashkar-e-Taiba, with TRF fronting responsibility to muddy India's investigations into the killings.
https://www.aljazeera.com/news/2025/4/23/what-is-the-resistance-front-the-group-behind-the-deadly-kashmir-attack

27 APR2025 The Resistance Front unequivocally denies any involvement in Pahalgam incident. Any attribution of this
act to TRF is false, hasty, & part of an orchestrated campaign to malign Kashmiri resistance,” its statement alleged. “Shortly after the Pahalgam attack, a brief and unauthorised message was posted from one of our digital platforms. After an internal audit, we have reason to believe it was the result of a coordinated cyber intrusion - a familiar tactic in Indian state's digital warfare arsenal,” it further claimed.
http://timesofindia.indiatimes.com/articleshow/120654688.cms

26APR2025 Pakistan called on Saturday for a “neutral” investigation into the killings of mostly Indian tourists in Kashmir that New Delhi has blamed on Islamabad, saying it was willing to cooperate and favoured peace. “Pakistan is fully prepared to cooperate with any neutral investigators to ensure that the truth is uncovered and justice is served,” said Pakistan's interior minister, Mohsin Naqvi.
https://www.reuters.com/world/india/india-pakistan-exchange-gunfire-2nd-day-ties-plummet-after-attack-2025-04-26/

The attack was similar to the 7OCT2023 attack against Israel, and that was planned by Iran and Russia. Since Russia is having problems with its war in Ukraine, they want more conflicts elsewhere to reduce the focus on Ukraine. A kinetic operation between India and Pakistan would not be so stupid for the Moscovites. Since they have infiltration in most terrorist groups, they have probably been planning this for some time.

It could have been done via Hamas or via Russian members of Lashkar-e-Taiba either with the consent of the TRF leadership or without their knowledge.

In this case I don't think Pakistan had any prior knowledge of what was going to happen, but ISI is not a truth teller and has used and trained terrorists against India before. Nor should you believe what the Indians say because RAW has been trained by the KGB.

15,227 posted on 04/27/2025 6:27:40 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 15222 | View Replies]


15,228 posted on 04/27/2025 6:32:59 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 15222 | View Replies]

To: PIF

15,229 posted on 04/27/2025 6:33:57 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 15228 | View Replies]

To: PIF
France is boosting arms production to supply Ukraine, with KNDS increasing output of Caesar howitzers and other weapons critical to Ukraine’s defense against Russia.

https://x.com/NOELreports/status/1916417845883240509

pootin did that!

15,230 posted on 04/27/2025 6:40:07 AM PDT by FtrPilot
[ Post Reply | Private Reply | To 15229 | View Replies]

To: PIF

It is interesting how myopic some people can appear. Our constitution demands that we protect ourselves from all enemies both foreign and domestic.

Much like the earlier talk of how sending munitions to Ukraine somehow made our southern border less secure or caused homelessness with our veterans.


15,231 posted on 04/27/2025 7:02:54 AM PDT by blitz128
[ Post Reply | Private Reply | To 15228 | View Replies]

To: PIF

15,232 posted on 04/27/2025 7:52:43 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 15229 | View Replies]

To: Dopey
🍈

This is the enemy, melon man


15,233 posted on 04/27/2025 7:56:41 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 15231 | View Replies]

To: FtrPilot
Your Clown Circus is over

PS: More action photos please

15,234 posted on 04/27/2025 8:06:48 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 15233 | View Replies]

To: blitz128
❗️🇷🇺Russian soldiers are now sharing photos with 🇰🇵North Korean soldiers in their ranks

https://bsky.app/profile/militarynewsua.bsky.social/post/3lnrt2si3ts24

15,235 posted on 04/27/2025 8:59:24 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 15231 | View Replies]

To: AdmSmith
AdmSmith: "Recession!
In Russia, industry has entered recession. (red and blue)
Civilian production output (orange) has fallen to a 2023 minimum"

We can be certain that once its war against Ukraine ends, Russia will experience a huge economic "hangover" from years of excessive military spending.
It happens after every war and can sometimes lead to serious social unrest.

However, after years of seeing predictions of imminent collapse of Russia's economy, I would not expect anything so drastic, so long as Putin remains in power.

15,236 posted on 04/27/2025 9:15:24 AM PDT by BroJoeK (future DDG 134 -- we remember)
[ Post Reply | Private Reply | To 15209 | View Replies]

To: BroJoeK

15,237 posted on 04/27/2025 9:28:02 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 15176 | View Replies]

To: PIF

To: BeauBo
According to World Air Forces 2023, below is what Russia has active and on order. This doesn't include losses or represent actual combat readiness. As far as I can tell, Russian manufacturers deliver about a 12-15 total fighter jets each year to VKS, including SU-57. In contrast, the US is producing 156 F-35s, 36 F-16 Vipers, and 18 F-15EX this year. F-16 production is going to increase next year due to increased foreign sales. F-18 E/F production wrapped up last year, so Boeing has significant untapped manufacturing capacity.

Of course, some of Russia's production is limited by what Russia can afford. It's also limited by sanctions, and of course foreign sales. As far as I see, zero foreign orders have been delivered over the past couple years, though Iran might get Egypt's cancelled SU-35s that have been sitting unsold for a couple years. VKS would love to have them to replace lost aircraft, but Russia desperately needs Iran's drones, missiles and artillery shells.

Russian Fighter Aircraft

ModelActiveOn Order
MiG-29/3524031
MiG-31129
Su-27/30/3535327
Su-3412717

206 posted on 02/29/2024 2:29:31 PM PST by ETCM (“There is no security, no safety, in the appeasement of evil.” — Ronald Reagan)
[ Post Reply | Private Reply | To 203 | View Replies | Report Abuse]

To: BeauBo; ETCM
OPERATIONAL PAUSE: After the loss of more than a dozen combat aircraft, Russia has apparently grounded its remaining A-50 AWACs aircraft. It is reported that Russian A-50 crew members are now calling in sick.

https://twitter.com/ChuckPfarrer/status/1763309749032886575

...A-50 crew members are now calling in sick.

207 posted on 02/29/2024 2:43:44 PM PST by FtrPilot
[ Post Reply | Private Reply | To 203 | View Replies | Report Abuse]

To: BeauBo; PIF
Latest update from Chuck Pfarrer:

KHERSON AXIS /2245 UTC 29 FEB/ UKR forces break up Russian attacks on Krynky. Ukrainian JDAM-ER hits RU depot and headquarters at Chelburda. RU ballistic missiles target apartment buildings in Kherson, causing numerous fires.

https://twitter.com/ChuckPfarrer/status/1763335963034698201


208 posted on 02/29/2024 3:05:59 PM PST by FtrPilot
[ Post Reply | Private Reply | To 207 | View Replies | Report Abuse]

To: SpeedyInTexas

Interesting watch on Finnish winter war, lots of parallels
https://m.youtube.com/watch?v=3jgrSxkvgYA

209 posted on 02/29/2024 5:17:29 PM PST by blitz128
[ Post Reply | Private Reply | To 1 | View Replies | Report Abuse]

To: PIF

I think we are only days away from a discharge petition.

“GOP Rep. Brian Fitzpatrick disclosed that several Republicans are prepared to go around Speaker Johnson to force aid vote”

“Prior to coming to Congress, Fitzpatrick served both as an FBI Special Agent and Federal Prosecutor. During his time in the FBI, he spent time in Kyiv, Ukraine and Mosul, Iraq, where he was embedded with U.S. Special Forces as part of Operation Iraqi Freedom.”

210 posted on 02/29/2024 7:17:27 PM PST by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 209 | View Replies | Report Abuse]

To: ETCM

ISW reports (29 Feb):

“The International Institute for Strategic Studies previously estimated that Russia has roughly 300 various Sukhoi fighter aircraft”

I assume that includes remaining Su-24s and Su-25s.

211 posted on 02/29/2024 8:44:35 PM PST by BeauBo
[ Post Reply | Private Reply | To 206 | View Replies | Report Abuse]

To: SpeedyInTexas

Then there is this:
Ukraine 406th battalion recorded a UFO on Feb 2024
https://www.youtube.com/shorts/-YNNgQoFxEQ

212 posted on 03/01/2024 2:47:33 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 210 | View Replies | Report Abuse]

To: BeauBo



213 posted on 03/01/2024 4:27:57 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 211 | View Replies | Report Abuse]

To: SpeedyInTexas

Moscovian losses in Tanks and Artillery to date 03/01/24.

Tanks 2764:
destroyed: 1810
damaged: 148
abandoned: 267
captured: 539

Towed Artillery: 347
destroyed: 201
damaged: 41
abandoned: 5
captured: 100

Self-Propelled Artillery: 682
destroyed: 529
damaged: 39
abandoned: 7
captured: 107

Multiple Rocket Launchers: 353
destroyed: 265
damaged: 32
abandoned: 2
captured: 54

Tanks destroyed: 1810
Artillery Destroyed: 995

214 posted on 03/01/2024 4:33:57 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 1 | View Replies | Report Abuse]

To: PIF

March 1.

24 days until Trump’s first criminal trial.

Couple of notes and my prediction.

This is a state trial, so Trump won’t be able to pardon himself for that.

I read where his lawyers said this case doesn’t have any jail time. That is false. What an idiot. There are 34 felony counts. I think each count can get up to 4 years??? But no required minimum jail time. That is very different than no jail time. Trump could get up to 136 years. Typically, first time offenders don’t get jail time. But Trump isn’t ‘typical’. This is a Dem prosecutor in a Dem city with a Dem jury pool.

Trial is expected to last about 1 month. So ends late April or early May.

I predict a conviction and a prison sentence of 2-4 years.

Trump will be in jail come May.

215 posted on 03/01/2024 7:14:57 AM PST by SpeedyInTexas (Defeat the Pro-RuZZia wing of the Republican Party)
[ Post Reply | Private Reply | To 214 | View Replies | Report Abuse]

To: SpeedyInTexas

Jail is were you go while awaiting court, trial and sentencing. For major crimes, prison is were you go after sentencing.

If DJT is convicted, he will spend the rest of his life in a maximum security prison, where after a certain period of time, he will be found hanged, with mysterious slits in his back and abdomen. Ruled a suicide. He just could not take it. Film at 11

216 posted on 03/01/2024 7:27:04 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 215 | View Replies | Report Abuse]

To: FtrPilot

Kremlin snuff box
https://t.me/s/kremlin_secrets

Helicopters were damaged in Crimea. The enemy attacked military targets on a large scale

On Friday, the enemy, using missiles and drones, attacked several military installations in Crimea. There were rumors about 10 missiles being shot down, but, unfortunately, there was some bad news.

According to our information, military infrastructure facilities in Sevastopol, near Simferopol and in the Saki region of Crimea were attacked. Some of the missiles were indeed intercepted, but, alas, not all. Some drones also hit the target.

It is preliminary known that the enemy damaged at least 3 Ka-52 helicopters at the Gvardeyskoye airbase near Simferopol. The condition of one fighter is also being clarified. So far there is little information.

In Sevastopol, a military facility was attacked directly within the city, but we are talking about a secret location and even our sources in the fleet chose not to talk about it. They only hinted that there could have been serious casualties among the officers.

In the Saki region, one of the air defense radars was disabled. Previously, there was a hit from an enemy drone.

217 posted on 03/01/2024 7:55:16 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 208 | View Replies | Report Abuse]

To: PIF

Storm Shadows over Crimea.

218 posted on 03/01/2024 8:07:42 AM PST by marcusmaximus
[ Post Reply | Private Reply | To 217 | View Replies | Report Abuse]

To: marcusmaximus

Storm Shadows over Crimea.

“Who knows what evil lurks in the hearts of men? The Shadow knows.” Orson Wells.

219 posted on 03/01/2024 8:16:18 AM PST by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 218 | View Replies | Report Abuse]

To: PIF; BeauBo; All
Excellent information...recommended reading for all...thanks for posting.

In Sevastopol, a military facility was attacked directly within the city, but we are talking about a secret location and even our sources in the fleet chose not to talk about it. They only hinted that there could have been serious casualties among the officers.

A secret location, most likely targeted by partisans.

220 posted on 03/01/2024 9:33:48 AM PST by FtrPilot
[ Post Reply | Private Reply | To 217 | View Replies | Report Abuse]

To: PIF
⚡️Some monitoring channels report that the 🇷🇺 Russian Su-35 fighter jet disappeared from the radars in the Mariupol area. It may have been shot down. We are waiting for information from the Air Force of 🇺🇦 Ukraine

https://twitter.com/front_ukrainian/status/1763509229824983357


221 posted on 03/01/2024 9:50:55 AM PST by FtrPilot
[ Post Reply | Private Reply | To 220 | View Replies | Report Abuse]

To: PIF
⚡️Russian media reports that at night, 🇺🇦 Ukrainian drones attacked the 🇷🇺 Russian Pantsir-S1 air defense system in the Belgorod region. The air defense system was damaged, two Russian soldiers were wounded.

https://twitter.com/front_ukrainian/status/1763472566306439267

The Pantsir-S1 air defense system is a short range (out to 18km), point defense system.

Most likely, it was being used to protect a high value target, such as an ammo dump.

Belgorod on Google Maps

222 posted on 03/01/2024 10:41:26 AM PST by FtrPilot

15,238 posted on 04/27/2025 9:51:03 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 228 | View Replies]

To: FtrPilot
Ukraine is producing 24 battalions worth of 155mm howitzers per year!!

The number 155mm howitzer battalions in other European armies:
🇩🇪 6
🇫🇷 6
🇵🇱 22
🇮🇹 8
🇪🇸 9
🇸🇪 2
🇳🇴 1
🇳🇱 2
🇩🇰 1
🇬🇧 1
https://x.com/noclador/status/1916135990537892130

The monthly production of the Ukrainian 155mm 2S22 Bohdana wheeled self-propelled howitzer has reached 36 units


15,239 posted on 04/27/2025 10:50:59 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 15230 | View Replies]

To: AdmSmith

15,240 posted on 04/27/2025 12:09:54 PM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 15239 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 15,201-15,22015,221-15,24015,241-15,260 ... 21,121-21,128 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson