Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

Skip to comments.

Attack On Europe: Documenting Russian Equipment Losses During The 2022 Russian Invasion Of Ukraine (2 year anniversary)
ORYX ^ | Since February 24, 2022 and daily | ORYX

Posted on 02/24/2024 5:59:01 AM PST by SpeedyInTexas

This list only includes destroyed vehicles and equipment of which photo or videographic evidence is available. Therefore, the amount of equipment destroyed is significantly higher than recorded here. Loitering munitions, drones used as unmanned bait, civilian vehicles and derelict equipment are not included in this list. All possible effort has gone into avoiding duplicate entries and discerning the status of equipment between captured or abandoned. Many of the entries listed as 'abandoned' will likely end up captured or destroyed. Similarly, some of the captured equipment might be destroyed if it can't be recovered. When a vehicle is captured and then lost in service with its new owners, it is only added as a loss of the original operator to avoid double listings. When the origin of a piece of equipment can't be established, it's not included in the list. The Soviet flag is used when the equipment in question was produced prior to 1991. This list is constantly updated as additional footage becomes available.

(Excerpt) Read more at oryxspioenkop.com ...


TOPICS: Military/Veterans
KEYWORDS: 0killthisthread; 1637borders; 3daywar; agitprop; alfredeblitz; americalast; angrykeywordtroll; anotherputinfail; anydaynowukrainewins; assistantdemsonfr; attackoneurope; beaubothebsartist; beauzo; bidenswar; bobomaximus; breevingroom; byepif; byespeedy; cantbreev; cheesymaximus; crazyivan; dailydeathfap; dailypropaganda; deadthread; deathcult; deepinthespamforest; delusionalzeepers; demyanganul; dimwit; dippythemelon; dualcitizenssuck; escalation; fishiemaximus; foreigntrolls; foreigntrollsonfr; formersovietofficers; freeploader; freeploadingspammer; gabbagabbahey; ghoulishdelight; gleefulnosegold; globohomo; goodriddance; hopium; irynazarutska; itsoveriwasright; jonboy; jonboyputinlover; keiththedimwit; kievstronk; liberalatpost7819; liedaboutleaving; melon; melonballsforever; melonlovesputin; melonlovesrussia; melonmemewarrior; melonmlrs; motherpif; muscovite; nato; omgputinputinputin; oyveygoyim; paidazovfans; paidazovtrolls; paidrussiantrolls; pancakemaximus; phdft; pifpouf; pifpuffs; planetzeep; polygamy; propagandareturns; put; putin; putinsfolly; putinstarted; putinswar; russia; russiandelusions; saintvolodymyr; siloviki; slaviccivilwar; slavictrolls; snufffilmsonfr; snufffilmtx; snuffpornforzeepers; snuffyfromtexas; spammyintexas; speedomaximus; speedycameback; speedyhadenough; speedyintroll; speedyisaliveandwell; speedyisdeadandfried; speedylied; stankazzintx; stankazztexicunt; staygonethistime; stenrynning; stinkstankstunkazz; stpetersburgtrolls; talkingtomypif; thisthreadisdead; tippecanoeandpiftoo; toldyouso; tothelastrussian; tothelastukrainian; ukraine; unhealthyobsession; usaidcheckbounced; usaidtrolls; vladtheimploder; warporn; wellbye; wildberry; yostanky; yurpstronk; zeepercirclejonk; zeepercreepers; zeeperdeathcult; zeeperhomeworld; zeeperloveazov; zeeperpr0n; zeepers; zeepersjustwannazeep; zeeperslovedeath; zeeperslovevindman; zeepersworshipdeath; zeepervictoryparade; zeepharder; zeeploaders; zeepyintexas; zipadeedoodah; zot; zottedintexas; zottyintexas
Navigation: use the links below to view more comments.
first previous 1-20 ... 15,161-15,18015,181-15,20015,201-15,220 ... 21,081-21,089 next last
To: AdmSmith

“The Muscovy state can not even provide potatoes”

Potatoes are a primary feedstock in the vodka supply chain.

Without vodka, Revolution would be certain.


15,181 posted on 04/26/2025 1:01:43 AM PDT by BeauBo
[ Post Reply | Private Reply | To 15178 | View Replies]

To: AdmSmith

“They need a lot more money or the bank (VTB) will go bankrupt.”

Second biggest bank in Russia - but all the banks are stressed by the rising tide of personal and business bankruptcies, combined with a crash in the real estate sector.

Notice where the proposed bailouts would come from - the National Wealth Fund. That punch bowl is about to empty out, just as it is most needed.

The Russian economy is heading into the rocks, full steam ahead.


15,182 posted on 04/26/2025 1:13:00 AM PDT by BeauBo
[ Post Reply | Private Reply | To 15179 | View Replies]

To: AdmSmith

The Russian Central Bank held their key interest rate steady at 21%, at Friday’s (25 April) meeting.

They said that inflation was too high to cut the interest rate now.

Wait until the printing presses go BRRRR, to address the tidal wave of bankruptcies - then we will see real inflation.

Full steam ahead!


15,183 posted on 04/26/2025 1:27:44 AM PDT by BeauBo
[ Post Reply | Private Reply | To 15180 | View Replies]

To: AdmSmith

The influx of cash for the “projects” are a smoke screen to bailout the bank. The “projects” will never be built.

The problem russian has is all their banks are in similar shape and there is not enough cash left to bail them all out

Look for the Kremlin to make withdrawals illegal for citizens, last thing they can afford is a bank run.


15,184 posted on 04/26/2025 2:54:30 AM PDT by blitz128
[ Post Reply | Private Reply | To 15179 | View Replies]

To: BeauBo

Also interesting is that China imports 40% of its food.


15,185 posted on 04/26/2025 3:00:04 AM PDT by blitz128
[ Post Reply | Private Reply | To 15181 | View Replies]

To: blitz128

Kupyansk front: Russian forces attempted an attack using quad bikes, but soldiers of Ukraine’s 14th Mechanized Brigade made sure it ended in failure.

In addition to this, there are some parts in this direction where Ukrainian forces regained previously lost positions.

https://bsky.app/profile/noelreports.com/post/3lnpcopntbk2l
1 min video


15,186 posted on 04/26/2025 4:16:04 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 15185 | View Replies]

To: gleeaikin; PIF; GBA; blitz128; FtrPilot; BeauBo; USA-FRANCE; marcusmaximus; ETCM; SpeedyInTexas; ...

Indications and Warnings | All the data that says Russia is losing... with Ragnar Guðmundsson
Presenting the Dashboard Tracking Russia's losses in Ukraine
https://lookerstudio.google.com/reporting/dfbcec47-7b01-400e-ab21-de8eb98c8f3a/page/p_wdrgjv1iyc and showing how to use it

https://www.youtube.com/watch?v=dtQgCTFIltg
1h video

Names of Russian officers killed un Ukraine
https://docs.google.com/spreadsheets/d/1InyFVmu1LoSjqcWTHe4iD9cR8CNiL-5Ke5Jiz_Mlvwc/edit

15,187 posted on 04/26/2025 4:37:37 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 15183 | View Replies]

To: AdmSmith
🍈

This judge is more dangerous to Americans than The Putin


15,188 posted on 04/26/2025 4:41:34 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 15174 | View Replies]

To: PIF

15,189 posted on 04/26/2025 4:46:51 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 15188 | View Replies]

To: gleeaikin

Perhaps I should add this interesting info: The Muscovy Military Staff in the Kremlin is as well using the Dashboard Tracking Russia’s losses in Ukraine. ;-)

But they are not showing it to Vlad the Impaler, although the page “Visually Confirmed Losses” would be suitable.


15,190 posted on 04/26/2025 5:54:45 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 15187 | View Replies]

To: AdmSmith

Reporting From Ukraine:
https://www.youtube.com/@RFU/videos

The complete transcript.

[ Russians Panic! Most Feared Ukrainian Unit Unleashed! ]

Today [ Apr 24, 8 pm ], there is interesting news from the Toretsk direction.

Here, the Ukrainian high command has completed the formation of yet another new army corps, led by the well-known Azov Brigade. Tailored to operate effectively in the dynamic frontline near Toretsk, this corps poses a major obstacle to Russian plans, potentially dealing a decisive blow to their entire Donbas operation.

The 12th Special Purpose Assault Brigade, Azov has long been one of Ukraine’s most iconic and formidable fighting units. Originally formed in 2014 as a volunteer regiment during the earliest stages of the war in Donbas, Azov evolved from a militia-style formation into one of the most disciplined and combat-experienced brigades in Ukraine’s National Guard.

Its composition of highly motivated volunteers, its emphasis on initiative and cohesion, and its legendary defense of Mariupol, especially during the siege of the Azovstal plant in 2022, cemented its place in modern military history. Azov has remained active in nearly every major flashpoint of the current war, and now, in a major structural shift announced this month, it will form the foundation of the newly created 1st Army Corps of Ukraine.

The establishment of the new unit, under the command of Colonel Denys “Redis” Prokopenko, marks a milestone in Ukraine’s military restructuring. This Corps will include five brigades:

the 12th Brigade, Azov,
the 1st Presidential Operational Brigade, Burevii,
the 14th Operational Brigade, Chervona Kalyna,
the 15th Operational Brigade, Kara-Dag, and
the 20th Operational Brigade, Lubart.

This means that Azov’s former area of responsibility, already one of the most active combat sectors in the Donetsk region, has expanded significantly, meaning Ukraine has essentially placed its most experienced and motivated commanders and soldiers in charge of one of the most critical portions of the eastern front.

This development comes at a pivotal time, with the frontline around Toretsk being one of the most volatile in Ukraine today, and each brigade joining the corps having proven itself in combat.

The 1st Presidential Operational Brigade “Burevii” is an elite unit that defended Kyiv in 2022 and later held critical lines in Bakhmut and the Kupiansk-Lyman axis.

The 14th Brigade “Chervona Kalyna” is known for its proficiency in urban warfare and effective coordination with drones and artillery, having rotated through Kreminna, Svatove, and Bakhmut.

The 15th Brigade “Kara-Dag”, composed largely of volunteers from southern Ukraine and Crimea, played a decisive role in halting a Russian breakthrough at Selydove and has seen extensive action in the Zaporizhzhia sector.

The 20th Brigade “Lubart”, newly elevated from a special-purpose battalion of the Azov brigade, has extensive experience in halting Russian advances and conducting ambushes in forested terrain near Kupiansk and Siversk.

This pool of experience will allow the 1st Azov Corps to conduct highly coordinated operations, whether defensive or offensive. Already, Azov’s leadership and initiative have helped stabilize the Toretsk sector.

In the south, they halted Russian gains at Niu-York and broke through to rescue encircled Ukrainian forces in the industrial zone. When Russian forces later infiltrated Shcherbynivka and nearby settlements, Azov launched a house-to-house clearing campaign through hundreds of buildings and basements, systematically pushing Russian units back to Nelipivka. As a result, Azov now exerts pressure on the Russian southern flank of Toretsk, setting the stage for future Ukrainian counterattacks.

What makes this transformation into a Corps even more consequential is the dynamic tactical situation in Toretsk itself. Russian forces are locked in brutal close-quarters fighting, expending thousands of troops in a desperate attempt to maintain a foothold. By prematurely committing reserves initially intended for a summer campaign toward Kostiantynivka, Russia is showing signs of operational overstretch.

This creates an opportunity for the new Corps, with its expanded area of responsibility and operational flexibility, to exploit Russian fatigue. Moreover, Azov and their new companion brigades’ proven ability to quickly adapt and dominate urban and semi-urban terrain, gives Ukraine a qualitative edge.

Overall, the creation of the 1st Azov Army Corps reflects Ukraine’s push to streamline command around experienced, high-performing units. Each brigade keeps its identity, but gains from centralized leadership and shared resources. This isn’t just symbolic but a strategic move to stabilize the eastern front. With elite brigades under one proven command, Ukraine aims to halt and reverse Russian advances, starting with Toretsk.

https://www.youtube.com/watch?v=TS8JzOd7OHY


15,191 posted on 04/26/2025 6:56:35 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 15190 | View Replies]

To: AdmSmith

Reporting From Ukraine:
https://www.youtube.com/@RFU/videos

The complete transcript.

[ 1 Year Worth of Ammunition Is Gone! ]

Today [ Apr 25, 8 pm ], there is important news from the Russian Federation. Here, the Ukrainians dealt another enormous blow to the enemy war machine by targeting one of the largest Russian arsenals. The massive facility storing hundreds of thousands of munitions of various types was engulfed in flames that continued to burn for days.

One night ago, a powerful explosion occurred at the 51st Arsenal of Russia’s Main Missile and Artillery Directorate near Kirzhach in Vladimir Oblast, approximately 70 kilometers northeast of Moscow. Despite the risk of sanctions and warnings issued by the local governor, dozens of residents published videos of the initial explosion, numerous secondary detonations, and the large-scale fire. Local authorities claimed initially that no one was hurt, but were soon forced to announce the evacuation of nearby villages and the closure of the main road connecting Moscow to Kirzhach.

The depot, spanning an area of approximately 3.5 sq km, was one of Russia’s largest and most strategically significant munitions storage sites. It reportedly housed up to 264,000 tons of various ordnances, or around 6,000,000 artillery shells, that could be enough for more than one year of combat operations. The arsenal included high-explosive artillery shells, anti-tank guided missiles, ballistic rockets, and solid-fueled surface-to-surface missiles, some potentially designated for Iskander and Smerch systems.

Preliminary reports indicate that the first blast was caused by a direct hit during the unloading of newly received munitions, which triggered a chain of catastrophic secondary detonations, sending shockwaves across the surrounding region. Massive plumes of dark smoke were seen for hours, while fireballs and repeated bursts were captured in dramatic detail on released footage. The visual evidence strongly suggests the ignition of high-energy solid propellants, further indicating the presence of advanced missile systems. The scale and intensity of the blast rendered much of the arsenal unsalvageable. This was later confirmed by released satellite data from NASA Fires, used for monitoring fires, showing a huge inferno on the site viewable from space.

While, as usual, the Russian government attributed the blast to a fire caused by safety violations in handling explosives, initial data from open-source military observers suggested that the explosion may have been the result of a Ukrainian long-range drone strike. Potentially it involved the domestically produced Palianytsia turbojet drone missile system, capable of striking targets deep inside Russian territory.

Developed during the ongoing Russian invasion and first unveiled in the summer of last year, Palianytsia is designed for precision long-range attacks. With an operational range exceeding 700 kilometers, and an estimated warhead between 50 and 100 kilograms of TNT, it can cause massive destruction to key logistical and military targets far from the front line.

The attack also highlights ongoing safety concerns regarding Russia’s ammunition storage practices, resulting in domino effects after initial Ukrainian strikes, as past Ukrainian strikes have often been able to trigger massive secondary explosions. The Ukrainian military has not officially claimed responsibility, but the incident aligns with previous Ukrainian operations, targeting similar facilities.

Since 2022, Ukraine has conducted a series of precise strikes on major Russian Missile and Artillery Directorate arsenals, aiming to undermine Russia’s logistical and military capabilities. Among them was the 107th Ammunition Depot in Toropets, where approximately 50,000 tons of ammunition was destroyed. Ukrainian Commander-in-Chief Oleksandr Syrskyi stated earlier this month that these strikes on Russian artillery arsenals have already cut the Russian artillery fire rate in half, so we should expect an even bigger reduction after this strike.

With Russian military doctrine heavily relying on massive artillery barrages to support offensive operations, it is no surprise that after previous major strikes, Russian frontline activity significantly slowed, revealing a direct operational impact of Ukrainian targeting of these facilities. As Russia prepares for a summer offensive, the latest strike is no coincidence, meant to undermine Russian firepower capabilities ahead of their planned final offensive.

Overall, each successful Ukrainian strike of this magnitude eliminates millions of shells that could be used against Ukrainian troops and civilians, and to support Russian offensives. The latest precision strike comes at a key moment, destroying up to a year’s worth of Russian ammunition, all the while Russia is gathering forces to launch its final offensive ahead of a possible freezing of the frontline. With Russians heavily relying on massive artillery barrages to support their attack, without the key.

https://www.youtube.com/watch?v=QwFvX99w8Rg


15,192 posted on 04/26/2025 7:07:33 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 15190 | View Replies]

To: AdmSmith
Reports that Russia has fully regained control of the Kursk region are fake, according to the General Staff. Ukrainian forces continue operations, and there is no threat of encirclement.

https://x.com/NOELreports/status/1916108495729971684


15,193 posted on 04/26/2025 7:27:16 AM PDT by FtrPilot
[ Post Reply | Private Reply | To 15187 | View Replies]

To: FtrPilot

15,194 posted on 04/26/2025 11:59:51 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 15193 | View Replies]


15,195 posted on 04/26/2025 12:00:15 PM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 15194 | View Replies]

To: JonPreston
Trump Says Zelensky Is The Stumbling Block to Peace in Ukraine, Will Meet With Putin Soon
15,196 posted on 04/26/2025 12:00:50 PM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 15195 | View Replies]

To: JonPreston

15,197 posted on 04/26/2025 12:01:10 PM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 15196 | View Replies]

To: JonPreston

STOP THE HAMMERING! pic.twitter.com/c6JHiRSZrR— Phantom Shadow (@Fuknutz) October 3, 2023


15,198 posted on 04/26/2025 12:01:33 PM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 15197 | View Replies]

To: JonPreston
"I'm very angry. Very, very angry"


15,199 posted on 04/26/2025 12:01:58 PM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 15198 | View Replies]

To: JonPreston

15,200 posted on 04/26/2025 12:03:12 PM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 15199 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 15,161-15,18015,181-15,20015,201-15,220 ... 21,081-21,089 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson