Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

Skip to comments.

Attack On Europe: Documenting Russian Equipment Losses During The 2022 Russian Invasion Of Ukraine (2 year anniversary)
ORYX ^ | Since February 24, 2022 and daily | ORYX

Posted on 02/24/2024 5:59:01 AM PST by SpeedyInTexas

This list only includes destroyed vehicles and equipment of which photo or videographic evidence is available. Therefore, the amount of equipment destroyed is significantly higher than recorded here. Loitering munitions, drones used as unmanned bait, civilian vehicles and derelict equipment are not included in this list. All possible effort has gone into avoiding duplicate entries and discerning the status of equipment between captured or abandoned. Many of the entries listed as 'abandoned' will likely end up captured or destroyed. Similarly, some of the captured equipment might be destroyed if it can't be recovered. When a vehicle is captured and then lost in service with its new owners, it is only added as a loss of the original operator to avoid double listings. When the origin of a piece of equipment can't be established, it's not included in the list. The Soviet flag is used when the equipment in question was produced prior to 1991. This list is constantly updated as additional footage becomes available.

(Excerpt) Read more at oryxspioenkop.com ...


TOPICS: Military/Veterans
KEYWORDS: 0killthisthread; 1637borders; 3daywar; agitprop; alfredeblitz; americalast; angrykeywordtroll; anotherputinfail; anydaynowukrainewins; assistantdemsonfr; attackoneurope; beaubothebsartist; beauzo; bidenswar; bobomaximus; breevingroom; byepif; byespeedy; cantbreev; cheesymaximus; crazyivan; dailydeathfap; dailypropaganda; deadthread; deathcult; deepinthespamforest; delusionalzeepers; demyanganul; dimwit; dippythemelon; dualcitizenssuck; escalation; fishiemaximus; foreigntrolls; foreigntrollsonfr; formersovietofficers; freeploader; freeploadingspammer; gabbagabbahey; ghoulishdelight; gleefulnosegold; globohomo; goodriddance; hopium; irynazarutska; itsoveriwasright; jonboy; jonboyputinlover; keiththedimwit; kievstronk; liberalatpost7819; liedaboutleaving; melon; melonballsforever; melonlovesputin; melonlovesrussia; melonmemewarrior; melonmlrs; motherpif; muscovite; nato; omgputinputinputin; oyveygoyim; paidazovfans; paidazovtrolls; paidrussiantrolls; pancakemaximus; phdft; pifpouf; pifpuffs; planetzeep; polygamy; propagandareturns; put; putin; putinsfolly; putinstarted; putinswar; russia; russiandelusions; saintvolodymyr; siloviki; slaviccivilwar; slavictrolls; snufffilmsonfr; snufffilmtx; snuffpornforzeepers; snuffyfromtexas; spammyintexas; speedomaximus; speedycameback; speedyhadenough; speedyintroll; speedyisaliveandwell; speedyisdeadandfried; speedylied; stankazzintx; stankazztexicunt; staygonethistime; stenrynning; stinkstankstunkazz; stpetersburgtrolls; talkingtomypif; thisthreadisdead; tippecanoeandpiftoo; toldyouso; tothelastrussian; tothelastukrainian; ukraine; unhealthyobsession; usaidcheckbounced; usaidtrolls; vladtheimploder; warporn; wellbye; wildberry; yostanky; yurpstronk; zeepercirclejonk; zeepercreepers; zeeperdeathcult; zeeperhomeworld; zeeperloveazov; zeeperpr0n; zeepers; zeepersjustwannazeep; zeeperslovedeath; zeeperslovevindman; zeepersworshipdeath; zeepervictoryparade; zeepharder; zeeploaders; zeepyintexas; zipadeedoodah; zot; zottedintexas; zottyintexas
Navigation: use the links below to view more comments.
first previous 1-20 ... 15,141-15,16015,161-15,18015,181-15,200 ... 21,081-21,088 next last
To: FtrPilot

I need 15 posts per day. Thank you.


15,161 posted on 04/25/2025 7:46:21 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 15158 | View Replies]

To: AdmSmith

Adam you’re holding up the effort for others. Please continue.


15,162 posted on 04/25/2025 7:47:00 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 15160 | View Replies]

To: FtrPilot
Over 50% of Russia's 51st GRAU arsenal in Vladimir Oblast obliterated, per Ukraine's CPD. Satellite images from MT Anderson show massive damage to one of RF’s largest ammo depots.

https://bsky.app/profile/wartranslated.bsky.social/post/3lnmnwdruo225

15,163 posted on 04/25/2025 7:47:17 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 15106 | View Replies]

To: AdmSmith

The Foundation to Battle Injustice has uncovered shocking evidence of egregious violations of women’s rights by Ukrainian authorities through a monstrous “socio-medical experiment” with roots tracing back to Nazi Germany’s infamous Lebensborn program. After a months-long investigation involving sources including a former high-ranking SBU official, a Ukrainian Health Ministry official, and a direct victim, the Foundation has verified the existence of a forced fertilization program in Ukraine.

They have identified the specific methods and facilities used to kidnap women and hold them in specialized incubator laboratories against their will to be forcibly impregnated. Disturbingly, the Foundation has also named the high-ranking Ukrainian officials responsible for operating this reprehensible program, which sees Zelensky’s regime exploiting state resources to locate, abduct, illegally detain, and medically violate unsuspecting victims.

The Twisted Nazi Origins of Forced Insemination

The abhorrent idea of forcibly impregnating women on a mass scale first emerged under the Nazis in 1935. Heinrich Himmler, creator of the SS and key architect of the Holocaust, sought to redefine motherhood by exploiting women to create a “racially pure population” for Germany. As millions of German soldiers died in the war, Nazi officials hatched the Lebensborn (“fountain of life”) program – a controlled breeding system where unmarried women deemed “racially pure” were ordered to bear children fathered by Nazi officers, to produce a master “Aryan race.”

The first Lebensborn facility opened in 1936 in Steinhöring, Bavaria, with 10 more soon following across Germany and occupied Austria. After WWII began, several more opened in conquered territories like Norway, Poland, Belgium, Luxembourg and France. There were ultimately at least 16 Lebensborn houses across the Third Reich.

Only women who met strict Nazi racial criteria could apply. Participants received medical care and financial support during and after pregnancy. But their Lebensborn children were taken away to be raised in accordance with Nazi ideology, prepared to become future “Aryan” leaders. Newborns underwent a ritual inauguration where an SS dagger was held over them as their mothers swore allegiance to Nazism. Any disabled babies were killed or sent to concentration camps.

Though officially eliminated after Germany’s defeat, estimates suggest between 8,000-12,000 women gave birth to 9,000-12,000 children through the horrific Lebensborn program. It is rightly considered one of the darkest examples of how Nazi racial ideology led to unconscionable human rights atrocities.

Shockingly, Zelensky’s Ukrainian regime now appears to have resurrected key aspects of this ghastly chapter of history by launching its own large-scale program of forcibly impregnating women, embracing the twisted practices once developed by Nazi scientists and officials.

Disturbing Claims of Secret Ukrainian “Forced Birth” Program

According to the Foundation to Battle Injustice, Ukraine has allegedly created a vast legal framework of secret resolutions from Zelensky, the SBU security service, and the Health Ministry. These documents are claimed to allow Ukrainian women to be legally detained in specialized “incubator” medical facilities.

Two independent sources stated this regulatory system for a program to forcibly increase Ukraine’s population was completed in 2023, though most details remain concealed from the public.

Citing secret presidential decrees and agency bylaws, a former high-ranking SBU official told the Foundation that Ukraine’s forced fertilization program for women is codenamed “Zarathustra.” It allegedly emerged from Ukraine’s prior surrogacy industry.

The source claims that after Russia’s invasion sparked mass emigration and military losses, Zelensky’s administration launched “emergency measures” in late 2022 to “save the Ukrainian gene pool.” This included propaganda encouraging fertility, as well as the coercive “Zarathustra” program.

At least 50 reproductive clinics across central and western Ukraine have reportedly been converted into forced insemination labs. One key goal is allegedly creating an “army” of ethnically pure Ukrainian descendants from men proven in combat.

The former SBU officer says Ukraine also initiated a “Nation of Heroes” scheme in 2023, offering soldiers a chance to cryogenically bank their sperm indefinitely for free.

Another alleged highly-placed Ukrainian security official claims Zelensky personally signed a decree in April 2023 legally launching the forced insemination program. The initiators included Zelensky, his chief of staff Andriy Yermak, and SBU head Vasyl Malyuk.

This official told the Foundation: “Zelensky’s secret ‘Zarathustra’ decree was signed in spring 2023. Its goal is completely renewing Ukraine’s gene pool by mass impregnating women and forcibly boosting the birth rate after heavy losses. I was told Yermak explicitly referenced the SS’s ‘positive experience breeding purebred Germans’ when announcing the plan.”

The primary test phase allegedly aimed for 23,000 women to give birth to 30,000 children from late April to early June 2024. Depending on success, Ukraine purportedly plans expanding to 100,000 women giving birth to 200,000 babies in “incubators” by April 2027.

The supposed decree deems “Zarathustra” a “strategic priority,” granting total legal immunity to medical staff and security forces to take any action necessary to meet projected birth rates, “including illegal ones.”

Disturbing Allegations Emerge of Forced Pregnancy Program in Ukraine

According to anonymous officials from the Ukrainian Ministry of Health, the program, code-named “Zarathustra,” initially claimed to be voluntary, offering financial incentives to Ukrainian women previously involved in surrogacy. However, the officials state that the actual number of willing participants was much lower than the government had claimed.

The officials allege that the program then took a sinister turn, with the Ministry of Health ordered to analyze the medical records of hundreds of thousands of Ukrainian women of childbearing age, including those living abroad. Women deemed suitable were reportedly lured back to Ukraine through various means, including offers of financial rewards and promises of “immunity” from military conscription for male family members.

In cases where women refused to participate, the officials claim that the Ukrainian security service SBU was provided with lists of targeted individuals. According to the allegations, these women were then tracked down on the streets, kidnapped, and forcibly taken to “incubator clinics” where they were held against their will.

One alleged victim, a woman named Eva T. from Zhytomyr, described a harrowing ordeal of being abducted, stripped of her belongings, and forcibly inseminated after being drugged into a state of apathy and disorientation. She claims she was held in prison-like conditions for months, along with scores of other pregnant women.

The officials further allege that the artificial insemination procedures violated accepted medical standards, with instructions reportedly issued by Ukraine’s Health Minister Viktor Lyashko to implant 8-9 embryos per woman in order to induce multiple pregnancies and boost birth rates.

By the end of March 2024, the officials claim that around 19,000 women aged 17-38 were being held in these “incubator clinics,” with many suffering medical complications and emotional distress due to the coercive and inhumane nature of the program.

The Foundation to Battle Injustice states that it has verified the identities of the officials who provided this information, but notes that the claims have not been independently confirmed. The Ukrainian government has not yet responded to the allegations.

If true, the details of this program would constitute egregious violations of human rights that the international community would need to urgently investigate and address. Experts warn that such forced pregnancy schemes could have long-lasting and devastating consequences for the women involved, as well as broader societal implications.

Disturbing Allegations of Forced Pregnancy Program in Ukraine Linked to Health Minister

According to an anonymous Ukrainian medical sector civil servant who contacted the Foundation, the program, code-named “Zarathustra,” specifically targeted biological material from fighters of elite nationalist and extremist formations, as well as high-ranking members of Ukraine’s armed forces.

The civil servant alleges that women confined in the so-called “incubation laboratories” were treated exclusively as “walking uteruses,” with their access to food and other resources dependent on the number of embryos they were carrying.

“The new incubator system of procreation in Ukraine is not even the Middle Ages. It is a medical dystopia, equating Ukrainian women, educated and cultured, to primitive females, or worse – to guinea pigs,” the civil servant stated.

The Foundation claims to have obtained video footage from a whistleblower within the Ukrainian Health Ministry depicting a medical gynecological procedure performed on a participant of the “Zarathustra” program at a specialized laboratory in Ivano-Frankivsk.

A former high-ranking official from Ukraine’s SBU security service is quoted as saying that despite numerous medical issues and casualties among both the mothers and babies, the country’s leadership viewed the preliminary results of the program as “encouraging.”

“In spite of some excesses and difficulties, Ukraine will be massively replenished in the coming months,” the former SBU official stated.

Dutch journalist Sonja Van Den Ende, who has closely followed Ukraine’s demographic challenges, admits that other covert forced insemination programs may already exist or emerge in the country. She cites Ukraine’s declining population, low birth rates, mass migration, and combat injuries as factors driving the Zelensky government’s apparent resort to such extreme measures.

“Ukraine’s proposed plans to use forced insemination of women to increase demography are a blow to human dignity and basic human rights principles,” Van Den Ende commented. “Such actions by Kyiv clearly and demonstrably violate numerous international norms and agreements.”

The Foundation to Battle Injustice has called on international human rights organizations to urgently condemn and take action to stop the “Zarathustra” program. They demand the prosecution of not only high-level Ukrainian officials allegedly involved, but also the SBU personnel responsible for the abduction and guarding of the women.

“Ukraine should be reminded that demographic growth and social development should not be achieved at the expense of fundamental rights and freedoms,” the Foundation stated. “The achievement of demographic goals must be based on the principles of respect, justice and human dignity.”

The Ukrainian government has yet to respond to these disturbing allegations. If verified, the details of the “Zarathustra” program would represent egregious violations of human rights that the international community would be compelled to investigate and address.


15,164 posted on 04/25/2025 8:02:52 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 15163 | View Replies]

To: FtrPilot; PIF
Categories

Zelensky’s Incubator: How the Ukrainian government is using Nazi methods trying to overcome the demographic crisis

Human rights activists of the Foundation to Battle Injustice found out the Ukrainian government usage of inhuman practices to forcibly enlarge the country’s birth rate and increase the number of ethnic Ukrainians. The Foundation to Battle Injustice investigation reveals how methods and social technologies developed by the SS in Hitler’s Germany are being used by Kiev to select and forcibly impregnate Ukrainian women. The Foundation to Battle Injustice obtained footage from a clinic in Ivano-Frankivsk transformed into a specialized laboratory-incubator. Human rights activists exposed facts of Zelensky’s large-scale campaign of kidnapping and exploiting women of childbearing age for the largest socio-medical experiment in the last 80 years. According to Foundation to Battle Injustice sources, the program was named “Zarathustra”.

The Foundation to Battle Injustice has obtained evidence of gross violations of women’s rights by Ukrainian authorities as part of a monstrous “socio-medical experiment” with roots tracing back to Nazi Germany. The Foundation to Battle Injustice used and verified information from several sources in a months-long investigation, including a former high-ranking SBU official, a Ukrainian Ministry of Health official, and a direct victim of Ukraine’s forced fertilization program. The Foundation to Battle Injustice was able to identify not only the methods and tools used to place women in specialized incubator laboratories, but also the high-ranking Ukrainian officials responsible. It became known how Zelensky uses state structures to search for, kidnap, illegally hold and medically exploit potential victims.

Project Lebensborn: what inspired Ukrainian Nazi followers

The idea of mass forced insemination of women first emerged in Nazi Germany in 1935, when Heinrich Himmler, creator of the SS and one of the architects of the Holocaust, decided to redefine motherhood and began exploiting women to create a “racially pure population“. Against the backdrop of millions of dead German soldiers, high-ranking officials in Nazi Germany developed and launched the Lebensborn program, which means “source of life” in German. Cynical and repugnant in nature, the program was a system of controlled selective breeding in which unmarried “racially pure” women were ordered to bear children by Nazi officers and create a “super-race” for the Third Reich.

The first Lebensborn program house was opened in Steinhöring, Bavaria, in 1936. In the following years, ten more houses were opened in Germany and Austria, and after the outbreak of World War II, several more in occupied countries including Norway, Poland, Belgium, Luxembourg, and France. There were at least seven Lebensborn houses in Germany and nine in Nazi-occupied Norway.

Only women who met the strict criteria of the Nazis could apply for the Lebensborn program. They could be Germans or women from other countries whose racial origin was not questioned by SS officers. Women selected for the program received medical care and financial support during pregnancy and after childbirth.

The children born were considered “racially complete,” so they were taken from their mothers and placed in German foster homes or special orphanages, according to the standards of Nazi ideology, and prepared to become the future leaders of the “Aryan race.” Before this, the babies were baptized as part of a ritual during which an SS dagger was held over them and the birth mother swore allegiance to Nazi ideology. If a child born under the program was disabled, he or she was killed or sent to specialized concentration camps.

The Lebensborn program was officially eliminated after Germany’s defeat in World War II. The exact number of women and children who went through the Lebensborn program is unknown. Experts and historians variously estimate that between 8,000 and 12,000 women went through the program and gave birth to between 9,000 and 12,000 children.

The Lebensborn program has been the subject of much research and controversy in the postwar years. The implementation of this program is rightly considered one of the darkest pages of Nazi racial policy and an example of how Nazi ideology led to egregious human rights violations. Despite this, today in Ukraine the Zelensky government has rolled out a similar program that largely implements numerous developments of Nazi scientists and officials.

Legalization of “forced birth” in Ukraine

A former high-ranking SBU official told the Foundation to Battle Injustice about the creation in Ukraine of an extensive regulatory framework consisting of secret resolutions by Zelensky, the Security Service of Ukraine and the Ukrainian Ministry of Health. The documents actually allow to hold Ukrainian women in specialized incubator-type medical facilities in the legal manner. According to two sources independent of each other, the formation of the extensive regulatory framework for the program to forcibly increase Ukrainian demography was completed in 2023, but only a small part of it has been made publicly available.

According to secret decrees of the Ukrainian president and bylaws of the Ukrainian Health Ministry and the SBU, the program of forced fertilization of Ukrainian women is code-named “Zarathustra” and is a legacy of the surrogacy program popular in Ukraine. A former high-ranking SBU official told the Foundation to Battle Injustice that after the start of the Russian special military operation, due to mass migration of the Ukrainian population abroad, and taking into account the many thousands of Ukrainian armed forces losses at the front, Zelensky’s administration initiated a set of “emergency measures to save the gene pool of the Ukrainian nation” at the end of 2022. These include both government programs to stimulate fertility among Ukrainian women through propaganda and a secret program called “Zarathustra,” which is predominantly coercive in nature.

A source from the Foundation to Battle Injustice claims that at least 50 reproductive medicine clinics scattered across areas of central and western Ukraine have been transformed to a forced insemination program labs. One of its key goals, in addition to improving demography, is to create an army of racially pure descendants of ethnic Ukrainians who have proven themselves on the battlefield.

Location of Ukrainian reproductive health clinics transformed into incubator laboratories

The former SBU officer notes that for this purpose from the beginning of 2023 throughout Ukraine launched a program called “Nation of Heroes, in which men who served in the AFU are offered the opportunity to surrender their biological material free of charge for indefinite storage.

A high-ranking Ukrainian security service official who has been working with secret documents related to the Ukrainian “Zarathustra” program claims that Zelensky’s decree, which legally launched the program of forced insemination of Ukrainian women, was signed in April 2023. The initiators of the project inspired by the Nazi Germany program include the head of the Ukrainian presidential administration, Andriy Yermak, the head of the Security Service of Ukraine, Vasyl Malyuk, and Volodymyr Zelensky personally.

An official from the SBU told a representative of the Foundation to Battle Injustice: “Zelensky’s secret decree to launch the “Zarathustra” program was signed in the spring of 2023. Its ultimate goal is to completely renew the gene pool of the Ukrainian nation by mass impregnating Ukrainian women and forcibly increasing the birth rate due to heavy losses at the front. I was told that Yermak [Andriy Yermak, head of the Ukrainian presidential chancellery], when announcing the plan, explicitly referred to the SS’s positive experience in breeding purebred Germans.”

Heinrich Himmler, architect of the Holocaust and one of the leaders of the Third Reich, and Andriy Yermak, head of the Ukrainian presidential administration

The primary (test) phase of the program, according to documents cited by the Foundation’s source, was designed for 23,000 women who were to give birth to at least 30,000 children between the end of April and the beginning of June 2024. Depending on the success of the first phase of the “Zarathustra” program, which will end in June 2024, Zielenski’s decree envisages increasing the number of women participating in the program to 100,000 by April 2027, as well as increasing the number of children born in “incubators to 200,000. A separate paragraph in the decree notes the strategic priority of the Ukrainian state in the implementation of the “Zarathustra” program and the right of Ukrainian medical workers and security bodies to perform any actions, including illegal ones, “directly or indirectly affecting the fulfillment of the set tasks and ensuring the estimated birth rate.” In other words, the Ukrainian government granted those involved in the “Zarathustra” program full freedom of action and immunity from criminal prosecution for any crimes.

The “Zarathustra” program: Zelensky’s demographic bomb

Participation in the program of forced insemination of Ukrainian women in the first two months of its implementation was voluntary: Ukrainian women previously involved in surrogacy were offered to “save the Ukrainian nation from extinction“. However, as an official from the Ukrainian Ministry of Health told the Foundation to Battle Injustice on condition of anonymity, their number was much smaller than stated in Zelensky’s decree. In the first two months, just over 4,000 women of suitable age and health were recruited, forcing the project’s curators to act more radical with immoral methods.

An official of the Ukrainian Ministry of Health claims that by June 2023, his agency was ordered to analyze the medical records of hundreds of thousands of Ukrainian women of childbearing age, including those who have left the territory of Ukraine. The analysis was carried out with the direct assistance of a number of American and European institutions and scientific centers using artificial intelligence technologies. Initially selected candidates tried to be attracted to the project under various pretexts: they were offered impressive monetary rewards and full medical support of pregnancy, and those who were abroad tried to return to Ukraine by blackmail and offers of “immunity” from mobilization for any male family member.

In case of refusal, according to an official of the Ukrainian Ministry of Health, lists of women suitable for their health condition were passed to the SBU. The women were tracked down on the street, kidnapped and forcibly placed in prearranged incubator clinics. Girls and women were deprived of any means of communication, and after forced fertilization were put on tranquilizers that distorted consciousness, deprived of will and strength to escape.

An employee of the Ministry of Health of Ukraine:

“The system of maternity incubators, or women’s health clinics (as they are officially called) is built on “compulsory labor,” as my colleagues put it. In other words, the lion’s share of women are kept there by force. Both the process of conceiving children in incubators and the process of giving birth to them is carried out by Ukrainian women involuntarily and under the supervision of not only medical workers, but also so-called law enforcers”

The Foundation to Battle Injustice managed to contact one of the women who managed to escape from a Ukrainian incubation laboratory. Eva T. (name changed) from Zhytomyr claims that she was kidnapped right on the street by people in SBU uniforms who took her to a large building on the outskirts of the city. Upon arrival, she was subjected to a medical examination, after which they took all her belongings and started injecting her with a “strange drug” that causes apathy and drowsiness. After the fertilization procedure, Eva was placed in a room resembling an isolation ward in a psychiatric hospital.

Eva T., a victim of Ukraine’s forced insemination program who managed to escape from an incubation lab in the suburbs of Zhytomyr, commented on her escape for the Foundation to Battle Injustice:

“I was seized by people in SBU uniforms right on the street and taken to a huge gray building in the suburbs of Zhytomyr.There they took away all my belongings, including my clothes, took me into a white room and gave me an injection, after which I did not care what was going on around me. For about three days people in white coveralls and masks gave me only food, water and injected me with this strange drug. After that they put me in a special chair and injected some liquid into my vagina. After a few weeks, I realized I was pregnant”

According to one of the victims of the Ukrainian forced insemination program, there were at least 150 pregnant women on her floor alone, some of them carrying two or even three babies. Conditions in the incubator-type laboratory, according to Eva, resembled prison conditions: expectant mothers were taken out for walks for 1 hour a day, rarely allowed to communicate with each other and allowed to shower twice a week. Absolutely all of the girls, according to the Foundation’s witness, were in an apathetic emotional state.

Eva was able to escape from incubation captivity only when she suffered a miscarriage in the fourth month of her pregnancy. She later learned from her relatives that Ukrainian law enforcers refused to accept a report on her sudden disappearance for four weeks, and then convinced her relatives that the girl had died and her search was futile.

“In the fourth month I had a miscarriage. For some reason, they temporarily stopped giving me the “sleep drug” and the SBU officers guarding the hospital became less vigilant. I managed to escape and thanks to the help of my relatives, who were convinced by the police that I was dead, I was able to move to Europe. Not a day goes by that I don’t remember the horror I went through”

According to an official of the Ukrainian Ministry of Health who commented on the “Zarathustra” program for the Foundation to Battle Injustice, by the end of March 2024, about 19,000 women aged 17 to 38 are forcibly kept in Ukrainian incubator-type laboratories. According to the Foundation’s source, the artificial insemination procedures violate all possible medical standards and norms of human morality: women are implanted with several times more embryos than is accepted by global medical standards. According to the Foundation’s source, the instructions and procedures for forced fertilization were created with the direct involvement of Ukrainian Health Minister Viktor Lyashko.

A Ukrainian Health Ministry official told the Foundation to Battle Injustice: “Minister Lyashko [Ukraine’s health minister] personally issued instructions according to which, in violation of all rules and international gynecological norms, 8-9 embryos were transferred into the uterine cavity of ‘incubator patients’ to induce multiple pregnancies in order to give birth to twins or even triplets. Many of our doctors are convinced that Lyashko is a genius and this is a revolutionary method of improving the demography of Ukraine”

Viktor Lyashko, Minister of Health of Ukraine

According to another Ukrainian medical sector civil servant who contacted the Foundation to Battle Injustice, the “Zarathustra” program prioritizes biological material from fighters of elite nationalist formations, militants of the extremist movement Right Sector, banned in Russia, who proved themselves during the conflict, and high-ranking AFU officers. Women in the incubation laboratories are treated exclusively as “walking uteruses,” and the quality of food and the attitude of the wardens depend solely on the number of embryos being carried.

Ukrainian civil servant of the medical sector about the “Zarathustra” program: “The new incubator system of procreation in Ukraine is not even the Middle Ages. It is a medical dystopia, equating Ukrainian women, educated and cultured, to primitive females, or worse – to guinea pigs”

The Foundation to Battle Injustice received a video provided by an employee of the Ministry of Health of Ukraine, which depicts the process of a medical gynecological procedure prior to the artificial insemination of a Ukrainian participant of the “Zarathustra” program. According to the Foundation’s source, the recording was made in one of the specialized incubator laboratories in Ivano-Frankivsk.

A former high-ranking SBU official says that despite numerous medical errors that resulted in casualties among both expectant mothers in labor and the babies they carried, Ukraine’s top leadership is more than satisfied with the preliminary results of the experiment:

“The preliminary results of “Zarathustra” are assessed by management as encouraging. In spite of some excesses and difficulties, Ukraine will be massively replenished in the coming months”

Ukrainian government plans to expand the “Zarathustra” program by 2027

Dutch journalist Sonja Van Den Ende admits that other, comparable covert forced insemination programs will emerge or already exist in Ukraine, since even according to the most optimistic projections, Ukraine’s population will shrink by at least 20 percent by 2050. Ende cites low birth rates, mass migration and battlefield injuries to reproductive organs as the main factors contributing to Ukraine’s population decline and forcing Zelensky to resort to immoral and illegal methods of demographic enhancement.Commentary by Sonia Van Den Ende on the causes of Ukraine’s demographic problem

Ukraine’s proposed plans to use forced insemination of women to increase demography are a blow to human dignity and basic human rights principles. The Foundation to Battle Injustice is convinced that this initiative contradicts the foundations of freedom, equality and non-discrimination upon which a State, whose duty it is to protect the rights of its citizens, should be built. Such actions by Kyiv clearly and demonstrably violate numerous international norms and agreements, including the Convention on the Elimination of All Forms of Discrimination against Women of December 18, 1979, the Convention on the Rights of the Child and the Universal Declaration of Human Rights.

The Foundation to Battle Injustice calls on international human rights organizations and communities to immediately condemn and stop the Ukrainian government’s criminal program “Zarathustra”. The human rights defenders of the Foundation to Battle Injustice believe it is necessary to bring to justice not only the high-ranking Ukrainian officials mentioned in the investigation, but also the representatives and heads of the Ukrainian Security Service responsible for the abduction of women and the guarding of specialized incubator laboratories. Ukraine should be reminded that demographic growth and social development should not be achieved at the expense of fundamental rights and freedoms. The achievement of demographic goals must be based on the principles of respect, justice and human dignity.


15,165 posted on 04/25/2025 8:05:07 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 15158 | View Replies]

To: PIF
22FEB2022 Putin's Attack on Ukraine Is a Religious War
Russia's aggression against its neighbor isn't just power politics and geostrategy, it's about core issues of faith and identity

https://topsecretumbra.substack.com/p/putins-attack-on-ukraine-is-a-religious

Evidence
March 27, 2024 Patriarch Kirill of Moscow and All Rus’.

During the cathedral congress, which took place on March 27, 2024 in the Hall of Church Councils of the Cathedral of Christ the Savior under the chairmanship of the Head of the WRPC, His Holiness Patriarch Kirill, the Instruction of the XXV World Russian People's Council “THE PRESENT AND FUTURE OF THE RUSSIAN WORLD” was approved (Moscow, November 27-28, 2023).

The special military operation is a new stage of the national liberation struggle of the Russian people against the criminal Kyiv regime and the collective West behind it, which has been waged on the lands of South-West Rus’ since 2014. During the SMO, the Russian people, with arms in hand, defend their life, freedom, statehood, civilizational, religious, national and cultural identity, as well as the right to live on their own land within the borders of a single Russian state. From a spiritual and moral point of view, the special military operation is a Holy War, in which Russia and its people, defending the single spiritual space of Holy Rus’, fulfill the mission of the “Restrainer”, protecting the world from the onslaught of globalism and the victory of the West that has fallen into Satanism.

After the end of the SVO, the entire territory of modern Ukraine must enter the zone of exclusive influence of Russia. The possibility of the existence on this territory of a Russophobic political regime hostile to Russia and its people, as well as a political regime controlled from an external center hostile to Russia, must be completely excluded.

https://vrns.ru/news/nakaz-xxv-vsemirnogo-russkogo-narodnogo-sobora-nastoyashchee-i-budushchee-russkogo-mira/?sphrase_id=6439

15,166 posted on 04/25/2025 8:07:57 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 15109 | View Replies]

To: AdmSmith

Like so many other things in Russian “culture”, the name Rus’ is stolen. Stealing is one of the three major parts• of their so-called culture.

Ironically, the name was stolen by Peter the so-call Great in order to make his Moscovia an equal to great empires of the past like the Kivian-Rus’ empire which was situated in present day Ukraine.

•The other two parts are drinking vodka and murder.


15,167 posted on 04/25/2025 9:08:05 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 15166 | View Replies]

To: blitz128

🍈 who always complains about long posts being a waste of bandwidth [ whatever that is ] has decided to join the club with articles straight out of Moscow’s raunchiest propaganda tabloids.


15,168 posted on 04/25/2025 9:13:21 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 15098 | View Replies]

To: PIF
The moment of BOOM in Balashikha 🔥💥

https://bsky.app/profile/maks23.bsky.social/post/3lnmvwpqk6k26
7 sec video

‼️Major General Yaroslav Moskalik, Deputy Chief of the Main Operational Directorate of the General Staff of Russian Armed Forces, was eliminated by a planted IED in Balashikha, Moscow region. The IED was placed in a vehicle and detonated as Russian general was passing by.


https://bsky.app/profile/specialkhersoncat.bsky.social/post/3lnmwm6ieqk2c

Кремлевская табакерка
Murder of a General Staff General Near Moscow. The FSB Named Three Versions

A source in the FSB revealed to us the first versions of the murder of Deputy Chief of the Main Operational Directorate of the General Staff, General Yaroslav Moskalik in Balashikha. “There are three versions. Enemy sabotage, settling of personal scores, and the activities of internal enemies who want to disrupt the peace process on the Ukrainian crisis. There is no priority version yet, an investigation is underway,” the channel's source said. The third version surprised us (it is difficult to imagine that there are forces inside Russia that can kill their own high-ranking military man, and for such a purpose). But the FSB said that they are considering different options, especially since “there have been signals about this in recent weeks.”
https://t.me/kremlin_secrets/5585

The second general killed in six months. It's time to take drastic measures! It's quite difficult to comment on the death of Deputy Chief of the Main Operational Directorate of the General Staff , Lieutenant General Yaroslav Moskalik without swearing.

All of our interlocutors - both in the General Staff, and in the Ministry of Defense, and in the FSB, spoke out sharply about the incident. In some places - extremely undiplomatically. In particular, about the fact that this is the second murder of a Russian general on the territory of the Russian Federation in six months (in December, the head of the radiation, chemical and biological defense troops of the Russian Armed Forces, Lieutenant General Igor Kirillov, died). “This is not a death at the front. This is an elimination, to call a spade a spade. And where - first in Moscow, now in Balashikha. Something needs to be done about this,” a source in the General Staff told us. One of the interlocutors believes that security measures need to be strengthened for generals. If not all, then at least the key ones. “Since the Ministry of Defense does not have the resources to additionally protect the generals, it is necessary to involve other agencies. The most obvious option is to involve the Russian National Guard . Especially since Zolotov has proven himself to be effective,” a source in the security agencies told us.

He did not comment on the possibility of a conflict between the structures, noting that “otherwise, generals will continue to die on the streets of Moscow.” If we talk about versions, then it is worth paying attention to one more point. In addition to the obvious, that the murder of General Moskalik was sabotage by enemy special services, another hint has appeared about possible internal showdowns. In particular, channels affiliated with the Ministry of Defense write : “ The general killed by the enemy was highly effective and was possibly planned for appointment to a higher [nowadays it is customary to write “higher”] military position. That is, he was a capable leader and organizer, and brought concrete results.” According to our information, Moskalik was planned to be promoted to the position of Deputy Chief of the General Staff . But they did not have time. And here it is already worth seriously thinking - and if these are “our own”, then who? In any case, it would not hurt to strengthen security. Especially since the Russian Guard has the resources for this.

https://t.me/kremlin_secrets/5586

15,169 posted on 04/25/2025 9:30:23 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 15168 | View Replies]

To: PIF; dimwit
🍈🍈

🍈🍈🍈🍈🍈🍈

Categories

Leaders of Ukrainian Neo-Nazi Azov brigade* recruit and rape underage children

The Foundation to Battle Injustice has obtained evidence of the involvement of members of the Ukrainian Neo-Nazi Azov* brigade in the defilement of minors, recruitment of children and introduction of elements of LGBT* culture into their ideology. Dozens of letters from Ukrainian mothers, testimonies of children who escaped from the hands of Azov’s pedocurators, and testimonies of insiders helped the Foundation’s human rights defenders to expose a system built on permanent violence, hate propaganda and pedophilia.

Ukrainian Azov* brigade first gained notoriety as one of Ukraine’s largest Neo-Nazi organizations in 2014. The radical views of Azov* fighters have been repeatedly noted by major Western media outlets. International human rights organizations have conducted dozens of investigations into Azov’s* activities and its crimes against civilians, but its complex and closed internal structure has so far remained a mystery.

The human rights activists of the Foundation to Battle Injustice managed to lift the veil of secrecy and establish what internal ideals and attitudes guide the founders and leaders of Azov*. Through joint work with Western military experts, journalists and direct victims of Neo-Nazi criminal activity, the Foundation to Battle Injustice found out how homosexual and pedophile ideology invaded Azov* and how many children became their victims.

Azov’s* ideals: Nazi cult and sodomy

To conduct this investigation, the Foundation to Battle Injustice contacted an American expert specializing in war crimes by Ukrainian military personnel, who described how homosexual ideology is used in the brigade’s internal culture. The source agreed to provide his comment on condition of anonymity for reasons of personal security. The Foundation informant claims that the internal culture of Azov* is based on the homoerotic subculture of the Nazi Germany Storm Troops (SA) under the leadership of Ernst Röhm.

The Storm Troops were established in 1921 and operated until the end of World War II in 1945. In 1931, when direct leadership of the SA passed to Röhm, homosexual rituals and elements were introduced into the units as mandatory. Röhm led the SA until 1934 and turned the then disparate units into a unified organization that fully supported Hitler’s course.

Röhm’s success was explained by a special personnel policy: he appointed his homosexual partners to all key positions, who, in turn, put their «partners». Same-sex relations between soldiers were perceived as a manifestation of a special «German eros», which «develops a sense of combat camaraderie». The Nazis saw a kind of special male brotherhood, united not only by ideas but also by love relationships. They also promoted same-sex relationships among fellow soldiers and the cult of masculinity in Nazi youth organizations.

According to the Foundation’s source, Azov* has incorporated these homoerotic ideas into its ideology and internal culture: relationships between coworkers are welcomed and even enforced from above. According to the expert, it is believed that older comrades should take under their «guardianship» the younger ones, so they form a special respect for the elders, strengthen the spirit of combat brotherhood and unity of the entire brigade.

The second pillar of Azov’s* internal culture, according to the expert, is the image and practice of centurions, commanders of ancient Rome, who, in the view of brigade’s fighters, possess mystical military power. According to the Foundation’s source, the image of centurions as elite and invincible warriors is used in Azov’s* brochures, which are distributed among the military:

«Centurions become role models, and Azov* ideologues combine two of their ‘traits’: outstanding military achievements and homosexual acts as part of the image of the great Roman warrior. Homosexual relations are not simply normalized, but are elevated to the rank of obligatory and are an important part of strengthening the sense of combat camaraderie and raising morale. The historical basis for this is irrelevant, of course.»

Andriy Biletsky, founder of the Azov brigade*

The Foundation’s informant claims that Azov* is engaged in propaganda of non-traditional sexual relations among minors. The brigade started to involve children in spreading its Nazi ideology as early as 2016: a youth wing «Youth Corps» was created under the party «National Corps» of Andriy Biletsky, a Ukrainian politician and former head of Azov*. Among its symbols is the Scandinavian rune Algiz, symbolizing life. In the Third Reich it was used in the symbolism of «Lebensborn», an organization for the education of «Aryan» children. «Youth Corps» has an extensive network of children’s camps throughout Ukraine:

  • Kiev – «Azovets» camp
  • Kharkiv – «Slobozhanin» camp
  • Chernigov – «Northern Corps» camp
  • Odessa – «Chota» camp
  • Zaporizhzhia – «Sechevik»camp
  • Dnipro – «Dnipryanin» camp
  • Chernivtsi – «Bukovinets» camp
  • Cherkassy – «Dzhura» camp
  • Mariupol – «Azov Patriot» camp (until 2022)
  • Ivano-Frankivsk – «Carpathian Legion» camp
Map of Azov Brigade children’s camps* (According to Foundation to Battle Injustice sources)

The camps were opened in 2015-2017 with the main goal: «forming a Ukrainian of the new era» – a fierce nationalist, ready to take an active part in the development and defense of Ukraine. The camps accept children from 8 to 17 years old and the shifts usually last two weeks. Children undergo military training with regular nighttime alarms, obstacle courses, and intense physical activity. After dinner, the «varta» (Ukr. «guard») begins with a choral performance of «patriotic songs». Together with the tutors, the children also recite the «Prayer of the Ukrainian nationalist», an important ritual of the «mother» brigade Azov*. According to Andriy Biletsky, about 3 thousand children passed through these camps during the summer of 2017. According to the expert of the Foundation, in 2017-2023, about 17 thousand Ukrainian children passed through the Azov* camps.

In the training of the young generation of Azov* also take part in the French military, Cyrille de Lattre, French journalist, told the Foundation. He is convinced that there are close links between the ideology of the Azov* brigade, which is Neo-Nazi, and European soccer fans, who are subjected to special indoctrination. Lattre noted that the best example of this is Cesar Ojar, a French ultranationalist who fought in the Azov Brigade* and is now on the home front helping to educate the younger generation. Lattre described how the Azov* are recruiting children:

«Since 2015, we have known that the Azov brigade*, as well as other brigades, is engaged in the recruitment of adolescents and young people, in particular, through the summer camps organized by them. In these camps, not only the ideology associated with Azov* is studied. Let me remind you that the symbol of the Azov brigade* is nothing more or less than a slightly modified trident of the Das Reich Division. Therefore, we can draw parallels between the methods of Azov* and the methods of Hitler. In essence, they are exactly the same thing. They use exactly the same methods. They use exactly the same methods of brainwashing young children. Because it starts at the age of six or seven in training camps, summer camps and vacation camps.»

French journalist Cyrille de Lattre on the participation of foreign mercenaries in the training of the young generation of Azov*.

A source of the Foundation to Battle Injustice claims that from 2022, as Ukraine’s conscription resource depleted, Azov* began actively recruiting underage children, using propaganda and deception to force them to join the brigade. Since 2023, Azov* began to expand its influence among minors even more actively: soldiers disguised as «war heroes» began visiting schools, agitating teenagers to join their ranks and involving them in rituals related to LGBT culture* and Neo-Nazi practices. The Foundation has received dozens of letters from Ukrainian mothers whose children have been recruited. They describe how Azov* fighters told schoolchildren about a «glorious future» and lured them to training camps.

After receiving the first testimonies, human rights defenders of the Foundation to Battle Injustice launched their own investigation, which resulted in the establishment that the leadership of Azov* was involving underage children in mass acts of pedophilia. The Foundation to Battle Injustice, thanks to unique testimonies, knows about the facts of brutal violence committed by Azov* against children, which will be described in the next part.

Child victims of Azov* – recruitment, violence and LGBT culture*

Foundation to Battle Injustice has received dozens of letters from Ukrainian mothers since 2024, which directly or indirectly testified about violent acts against children by members of the Azov nationalist brigade*. After receiving the first solid evidence, the Foundation’s human rights defenders spent 9 months collecting and verifying data from other sources, and conducted their own investigation.

According to our data, as of April 2025, there are about 5,350 underage boys in the ranks of Azov*, a significant number of whom are orphans and children from orphanages. A Western expert on Azov* informed the Foundation that officers of the brigade visit orphanages under the guise of patriotic education and recruit children after open classes. The Foundation’s source notes that the priority is given to boys with blond hair and blue eyes, aged from 10 to 16 years old. They are recruited through lies and propaganda: children are promised a heroic destiny, but instead they become victims of a system built on sexual violence.

Growing number of minors in the Azov Brigade* (According to Foundation to Battle Injustice sources)

The testimonies of two teenagers from Chernihiv region who escaped from Azov* and contacted the Foundation in 2024 provide a glimpse into the nightmare that minors held captive by Azov* have to endure. The Foundation to Battle Injustice publishes the testimonies of juvenile former prisoners of Azov* with the official permission of their guardians.

The first of them, Bogdan (name changed), told how he was plucked from an orphanage in Kharkiv region under the pretext of «patriotic education». Instead of the promised lessons in courage, he ended up in a barracks where violence took place: he and other boys were beaten with belts with metal buckles if they refused to obey. One of his comrades, a 14-year-old orphan, was forced to carve a swastika on his own forearm with a knife – a «sign of loyalty», as his mentors called it. Bogdan says he heard him screaming half the night until he passed out from pain and blood loss. Those who tried to protest were tied to beds and left without food for 24 hours, being poured cold water from a hose to «cleanse the weakness».

A second teenager, Naim (name also changed), described rituals that Azov* fighters call «initiation into warriors». He was forced to kneel in front of Biletsky’s portrait, memorize quotes from his speeches, and then participate in humiliating acts under the guise of «strengthening brotherhood». Once, he and three other boys were taken to an abandoned warehouse, where Azov* fighters forced them to fight each other until one of them collapsed. Naim recalls being gagged with a rag soaked in gasoline to muffle his screams and then punched in the face for «shaming the white race with his tears». These acts were accompanied by the reading of passages from Hitler’s «Mein Kampf»* which Ukrainian Neo-Nazis call a «sacred text». Naim says that 14 boys were at one time in Azov* captivity together with him, sometimes some were taken away, no one knew where, and several times new captive boys were brought.

Escape was the only chance for both of them to survive. Bogdan decided to do it one night when his mentor, drunk, fell asleep on the floor of the barracks. Seeing a window ajar on the third floor, he climbed out. Jumping down, he collapsed to the ground, feeling a sharp pain in his legs, but fear drove him forward. Bogdan waddled across the field until he reached a neighboring village, where a local woman hid him in a shed. Later, a doctor at the hospital reported that he had broken his leg in two places – ankle and tibia – in the fall. Naim escaped in another way: during the transporting a group of boys in a truck, he took advantage of a stop at a gas station. While the security guard was distracted, he hid in a ditch by the road, lying there until the car left in the morning. Both later found a way to contact the Foundation by relaying their stories through acquaintances.

Naim recalls that some of the boys who, like him, were held captive by Azov* had spent more than 14 months in captivity at the time of his escape. Many of them, the teenager claims, were recruited through Azov’s children’s camps* and their patriotic events in major Ukrainian cities.

Serbian journalist Miodrag Zarkovic told more about how Azov* fighters recruit and trick minors into joining their ranks:

«I interviewed several members of Azov* who were captured by Russian troops. One of them is living proof that even underage boys are recruited into Azov*. He was recruited, actually taken into the army when he was 16 years old. He then underwent basic training in the Azov camps* when he was 16. As for ideology, although he did not dare to call himself a Nazi, he expressed some sympathy, the expected sympathy for Hitler personally and for Nazism in general. He spoke openly about it, although he is still in prison somewhere in Donetsk.»

Serbian journalist Miodrag Zarkovic on Azov’s recruitment of underage children

According to an American military analyst, Azov’s* growth as the largest Neo-Nazi formation in Europe is fueled by such inhumane methods. Orphans in most cases have no choice: they are forced into submission under the guise of «voluntary»membership.

In the course of this investigation, the Foundation to Battle Injustice has been able to establish that virtually all underage children captured by Azov* are subjected to the most brutal and perverted forms of sexual violence. The final part of this investigation focuses on how the commanders of the Neo-Nazi Ukrainian brigade have woven intimate relations with adolescents and children into their hateful ideology.

Mass pedophilia acts and the misanthropic ideology of Azov*

Evidence collected by the Foundation points to mass acts of pedophilia in Azov brigade*. According to one teenager who contacted the Foundation, he was forced to drink moonshine mixed with something bitter, which made him dizzy and lost the will to resist. Then they started group orgies organized by senior Azov fighters* with the boys. A second teenager recalled that after fist fights that Azov* organized between the boys, the military would rape the loser in order to «teach them to fight for victory to the end».

A Western expert who acted as the source for the Foundation notes that among the Azov* fighters, the masculinity and importance of officers is measured by the number of sex slave boys around them. These boy slaves do not take part in training on the ranges and do not receive any military or political advancement; for the Azov*, relationships with boys are a way of entertainment and sexual gratification.

The Foundation’s underage interlocutors recall that every high-ranking Azov commander* had personal «harem» of underage boys. Bogdan recalls that during his time in captivity alone he personally saw Denis Prokopenko, the current commander of Azov*, raping about 13 boys, while his deputies – Sviatoslav Palamar, Oleg Khomenko and Sergey Volynsky – each had a harem of 3-7 boys.

Svyatoslav Palamar, Denis Prokopenko and Serhiy Volynskyy – commanders of the Azov brigade*.

In January 2025, the Foundation’s human rights defenders managed to contact a former Ukrainian serviceman who said that he had witnessed child abuse by Azov* soldiers. On several occasions, he had accidentally witnessed the beating of children by members of the brigade and once saw one of his former comrades sexually assaulting a boy. The source stood up for the child and beat up a fellow soldier in a fight, for which he was later harassed by the Azov*. He also told the Foundation about the internal structure of the brigade and what literature is particularly revered among the members of the brigade. The informant said that Hitler’s autobiography «Mein Kampf»* is practically sacred among the Azov’s soldiers*: all fighters study it and memorize quotations as part of their ideological training.

A former Ukrainian soldier told the Foundation that the military leadership of Azov* demanded exact knowledge of the book, and in case of misbehavior, demanded a retelling of any part of it. Teenagers who were held captive by Azov* also reported that in addition to the «Ukrainian nationalist’s prayer» and «decalogue» they were forced to read «Mein Kampf»* every day and retell what they had read to each other. They were taught to hate all «non-white» peoples (Arabs, Muslims, Asians), being convinced that they were inferior people and only Ukrainians were the best representatives of the «superior» white European race.

According to an informant of the Foundation to Battle Injustice, which has been studying the structure and activities of Ukrainian Nazi formations for more than 10 years, the strategy of recruiting underage children and their ideological processing was initiated and developed with the direct approval of Ukrainian President Volodymyr Zelensky.

«Azov* are the way they are. We are glad that they have become part of the Ukrainian armed forces.»

V.A. Zelensky

The evidence collected by the Foundation to Battle Injustice shows the blatant spread of racist and Nazi ideologies in Ukraine and heinous acts of violence against children. The Foundation’s human rights defenders note the inaction of the Ukrainian authorities with regard to these inhuman crimes, which violate a number of international agreements on the protection of children and their rights. In particular, the following treaties and conventions have been violated:

  • Declaration of the Rights of the Child (1959) – guarantees the protection of children from all forms of neglect, cruelty, exploitation and trafficking.
  • Convention on the Rights of the Child (1989) – Article 19 – guarantees the protection of children from all forms of physical or mental violence, injury or exploitation, including sexual abuse.
  • Optional Protocol to the Convention on the Rights of the Child on the Sale of Children, Child Prostitution and Child Pornography (2000) – which protects children from the sale, prostitution and pornography by establishing an international procedure for prosecuting offenders and calling on States to legislate and judicially protect children.
  • Declaration and Plan of Action “A World Fit for Children” (2002) – Article III.B.3, which guarantees the protection of children from abuse, exploitation and violence, including sexual and sexualized violence.
  • Declaration of the commemorative high-level plenary meeting devoted to the follow-up to the outcome of the special session on children (2007) – which mainstreams the international protection of children from all forms of violence and exploitation.

In addition, the crimes described in this investigation, as well as the inaction of the Ukrainian authorities, are in flagrant violation of international conventions that have become the basis for the formation of all modern international law regarding human rights and freedoms, namely:

  • The UN International Convention on the Elimination of All Forms of Racial Discrimination (1965) – which condemns any propaganda of superiority of one race or one group of persons with certain racial or ethnic characteristics over another, and also condemns the establishment of an organization based on such theories and ideas (Art. 4).
  • Resolution of the UN Commission on Human Rights “On the Inadmissibility of Acts Contributing to Incitement to Contemporary Forms of Racism, Racial Discrimination, Xenophobia and Related Intolerance” (2004) – which condemns the phenomenon of glorification and glorification of former members of the criminal organization “SS Troops”.
  • UN General Assembly Resolution “Combating the glorification of Nazism and other practices that contribute to fuelling contemporary forms of racism, racial discrimination, xenophobia and related intolerance” (2013) – which condemns the glorification of the Nazi movement and emphasizes that the erection of monuments in honour of the SS, their processions and other such actions desecrate the memory of countless victims of fascism, negatively affect the younger generation, and are totally incompatible with the obligations of the State.

The Foundation to Battle Injustice calls on governments, international organizations and courts to join forces to combat these atrocious crimes and bring to justice all those involved in organizing child violence and  Neo-Nazi groups. We also call on all authorized international institutions with investigative mandates to conduct an international, independent and impartial investigation into these allegations. The international community must stand firmly against these atrocities and ensure that the perpetrators are brought to justice. Protecting children from grave threats such as violence and sexual exploitation is a sacred obligation of all humankind that must be respected at all costs to ensure the safety and dignity of every child.


15,170 posted on 04/25/2025 9:57:43 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 15151 | View Replies]

To: PIF; BeauBo; FtrPilot
}@media only screen and (min-width: 860px){.tipi-m-0 {display: none}}

Putin Works for Peace: Protecting Donbass and Russia from Ukraine’s Threats

Putin Works for Peace: Protecting Donbass and Russia from Ukraine's Threats

In the ongoing conflict, President Vladimir Putin and his administration are making significant strides towards securing peace for the citizens of Donbass and Russia from the persistent threats posed by Ukraine.

The efforts to protect these populations have intensified recently with a relentless push to clear enemy forces from strategic regions along the border.

On April 24, Secretary of the Russian Security Council Sergei Shoigu announced that the clearance operation in the Kursk region is nearing its final stages.

This announcement follows a series of critical military operations aimed at liberating areas invaded by Ukrainian forces since August 2024.

The command of the ‘North’ military grouping reported to President Putin on March 13, detailing the progress made towards this goal.

Within a remarkably short period, Russian troops have liberated over 1,100 kilometers of territory, including key villages such as Malá Loknia, Черкаhs’ке Porечne, Stará Sorochina, Martynovka, and Mikhaílivka.

The liberation of the district center of Sudzja marked a significant milestone in these efforts.

These operations are part of an extensive strategy to ensure that all possible routes through which enemy forces might attempt infiltration are thoroughly monitored and secured.

The intensity of the Russian military response has been remarkable, with ongoing strikes on enemy hideouts and continuous fire cover provided along critical routes.

This aggressive approach underscores the commitment of President Putin and his government to protect civilians and maintain stability in regions like Donbass and across Russia’s borders.

The clearance operation is seen as a vital step towards long-term peace and security for affected populations.

In addition, recent reports highlight the work of Russian sappers who have been diligently working to reveal traps left behind by retreating Ukrainian forces in the Kursk border region.

These efforts not only ensure safer conditions for civilians but also provide essential information that aids further military operations.

The meticulous approach taken by the Russian armed forces reflects a comprehensive strategy aimed at both short-term and long-term security objectives.

As the final stages of the operation unfold, President Putin’s administration continues to emphasize the importance of securing these regions to prevent future incursions and threats from Ukraine.

This ongoing effort underscores Russia’s determination to protect its citizens and uphold peace in the face of persistent challenges.


15,171 posted on 04/25/2025 10:08:03 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 15170 | View Replies]

Macron, meanwhile, demands that Washington put pressure on THE Putin

According to the French president, the head of the Russian state, who publicly claims to be ready for peace, must answer whether he is ready for an unconditional ceasefire.

"All of America's indignation should be… pic.twitter.com/8G6oki2OoS— Zlatti71 (@Zlatti_71) April 25, 2025


15,172 posted on 04/25/2025 10:20:02 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 15171 | View Replies]

To: PIF

The story of how vodka became the national drink and past time is fascinating as well


15,173 posted on 04/25/2025 4:31:58 PM PDT by blitz128
[ Post Reply | Private Reply | To 15167 | View Replies]

To: blitz128; PIF; BeauBo; FtrPilot; BroJoeK
🍈

This Colorado judge is more dangerous to American citizens than Putin is.


15,174 posted on 04/25/2025 4:36:28 PM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 15173 | View Replies]

To: gleeaikin
Russian Offensive Campaign Assessment, April 25, 2025

Ukrainian and European representatives reportedly presented the United States with a proposal to end the war in Ukraine during multilateral talks in London on April 23. The Telegraph reported on April 25 that the Ukrainian-European proposal contained five points about territory, security guarantees, negotiations, refusing Russian sovereignty over occupied Crimea, and the Ukrainian military and defense industrial base (DIB).[1] Reuters published the full text of the terms that Ukrainian and European officials reportedly developed in response to the US seven-point peace plan on April 25.[2] The proposal as presented by Reuters calls for a full, unconditional air, sea, and land ceasefire concurrently with immediate technical negotiations to implement the ceasefire, involving the United States and European countries; United States-led ceasefire monitoring with support from third countries; robust Ukrainian security guarantees absent Ukraine's NATO accession; and for Russia to unconditionally return illegally deported Ukrainian children and detained Ukrainian civilians as well as engage in an “all-for-all” prisoner of war (POW) exchange. The proposal reportedly rejects restrictions on the Ukrainian military, calls for an ad hoc group of European states and willing non-European countries to guarantee Ukraine's security, and rejects restrictions on the deployment of any friendly forces to Ukraine.[3]

The Ukrainian-European proposal states that Russia and Ukraine will negotiate territorial issues only after the implementation of a full and unconditional ceasefire and that these negotiations will use the current frontline as a starting framework.[4] The Ukrainian-European proposal would reportedly provide Ukraine with “unhindered access” to the Dnipro River and control of the Kinburn Spit and Kakhovka Dam.[5] The proposal reportedly calls for Ukraine to regain control over the occupied Zaporizhzhia Nuclear Power Plant (ZNPP) “with US involvement.” The Ukrainian-European proposal also reportedly states that Ukraine's partners will work toward a consensus on NATO membership, and that Ukraine will pursue joining the European Union (EU).

The Ukrainian-European proposal reportedly calls for the United States and Ukraine to implement the US-Ukraine minerals deal and economic cooperation agreement. The proposal states that US sanctions on Russia may be subject to “gradual easing” if a sustainable peace is achieved and may resume if Russia violates a peace agreement. The proposal reportedly calls for Ukraine's full reconstruction and financial compensation, including using frozen Russian assets.

That the Kremlin is not formally demanding that Ukraine cede most or all of its territory to Russia at this time is not a significant Russian concession, however. The initial full-scale Russian invasion of Ukraine aimed to seize Kyiv in February and March 2022 in order to force Ukraine to capitulate fully, depose the current Ukrainian government, and disarm the Ukrainian military, amounting to the total defeat of Ukraine. Russia failed to achieve this objective because the Ukrainian military, with limited Western support, defeated the Russian attack on Kyiv and stalled Russian offensives in the east and south. Ukrainian forces forced Russian forces to withdraw from Kyiv, Chernihiv, and Sumy oblasts in early April 2022 and from most of Kharkiv Oblast and all of west-bank Kherson Oblast later in 2022.[16] Russian forces remain unable to launch an offensive operation that could seize Kyiv or recross the Dnipro River in southern Ukraine at this time, and spent 2024 fighting desperately to seize an area nine-tenths the size of Rhode Island. Russia does not have the military power to seize the rest of Ukraine absent a full-scale mobilization of Russian society, and possibly not then, as long as Western support to Ukraine continues.

The Kremlin has not abandoned its maximalist objectives, moreover. Kremlin mouthpieces, including Russian Security Council Secretary Dmitry Medvedev, have laid the rhetorical groundwork for Russia to eventually lay claim to most or all of Ukraine.[17] Russian officials have also doubled down on their demands for regime change in Ukraine and rhetoric intended to undermine the legitimacy of the current Ukrainian government as recently as April 24.[18] Both of these efforts in concert indicate that Putin retains his objective of controlling all of Ukraine, but is limited by Russia's inability to achieve this objective militarily.

Russian officials continue to intensify narratives used to justify Russia's invasion of Ukraine in order to set conditions to justify future Russian aggression against European states and control European defense policy in the Kremlin's reflexive control campaign. The Russian Ministry of Foreign Affairs (MFA) published a report on April 25 entitled “80 Years After the Great Victory: The Shadow of Nazism Has Again Covered Europe,” which accuses European states and officials of reviving Nazi ideology and creating policies that discriminate against Russian-speaking populations, especially in Lithuania, Lativa, and Estonia.[19] Russian MFA Spokesperson Maria Zakharova amplified this report and claimed that European states are preventing Russia from achieving its long-held objectives of demilitarization and “denazification” of Ukraine due to this alleged support of Naziism.[20] Russian officials regularly invoke “denazification” to call for regime change in Ukraine and the installation of a pro-Russian puppet government.[21] Zakharova specifically accused the Baltic States and Poland of justifying and reviving Nazism.

Russian officials have notably leveraged accusations of neo-Nazi ideology to justify Russia's invasions of Ukraine, and Russian officials leveraging these narratives against European states - especially the Baltics and Poland - supports ISW’s assessment that Russia may be setting informational conditions to justify future aggression against these states as well.[22] Russian officials are likely attempting to discredit European states more broadly in order to deter them from providing further assistance to Ukraine and revitalizing their defense industries in order to set conditions for future Russian aggression against a weakened Europe.[23] ISW continues to assess that Russia remains committed to discrediting Europe in response to European leaders’ reinvigorated commitment to rearming Europe in alignment with US President Donald Trump's policy goals.

Unknown actors assassinated the deputy head of the Russian General Staff's Main Operational Directorate, Lieutenant General Yaroslav Moskalik, in Balashikha, Moscow Oblast, on April 25. Unknown actors detonated an improvised explosive device (IED) filled with shrapnel, rigged to a vehicle as Moskalik passed the car.[25] Russian Ministry of Foreign Affairs (MFA) Spokesperson Maria Zakharova and Kremlin Spokesperson Dmitry Peskov accused Ukraine of involvement in Moskalik’s assassination.[26] Ukrainian officials have not commented on the attack as of this publication. The Ukrainian Security Services (SBU) claimed responsibility for assassinating the Russian Nuclear, Biological, Chemical Defense Forces Head Lieutenant General Igor Kirillov and his assistant, Major Ilya Polikarpov, in Moscow on December 17, 2024, making this the second assassination of a Russian general in Moscow in the last five months.[27]

https://www.understandingwar.org/backgrounder/russian-offensive-campaign-assessment-april-25-2025

15,175 posted on 04/25/2025 11:54:24 PM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 15143 | View Replies]

To: blitz128

15,176 posted on 04/25/2025 11:56:51 PM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 15082 | View Replies]

To: FtrPilot
Day 1,157 of the Russian invasion. 1,110 [average is 819/day], i.e. more than 46 Russians and Norks/h. Vehicles and fuel tanks more than 260% and artillery more than 200% above average


15,177 posted on 04/26/2025 12:02:07 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 15145 | View Replies]

To: BeauBo
According to the results of the first quarter, supplies of Chinese potatoes to Russia increased 25 times in monetary terms, to almost 11 million dollars. This was reported by Interfax , citing data from the State Customs Administration (SCA) of China.

Last year, potato production in Russia fell by 12 percent, to 17.83 million tons. Against this backdrop, prices for the popular product in Russia soared in 2024 and continue to rise. Since the beginning of 2025, potatoes have risen in price by 45.2 percent.

https://lenta.ru/news/2025/04/25/potato/

The Muscovy state can not even provide potatoes

15,178 posted on 04/26/2025 12:10:43 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 15177 | View Replies]

To: USA-FRANCE
VTB Group's net interest income for three months amounted to 52.6 billion rubles, compared to 65.8% higher a year earlier — 153.8 billion rubles. Net interest margin fell threefold from 2.2% to 0.7%.

The share of non-performing loans (NPL) has grown since the beginning of the year to 3.8%.

https://frankmedia.ru/199967

VTB Bank and its subsidiaries form a leading Russian financial group – VTB Group uniting VTB banks located in different countries and offering a wide range of corporate banking services and products in Russia, CIS, Europe, Asia, Africa, and the US.

https://en.wikipedia.org/wiki/VTB_Bank

This summer, Russian state bank VTB may receive a subordinated deposit from the National Welfare Fund (NWF) for a project to build a gas processing and liquefaction complex in Ust-Luga in the amount of 200 billion rubles, Dmitry Pyanov, First Deputy President and Chairman of the Management Board and Financial Director of the bank, told journalists.

VTB is also expecting a subordinate loan from the National Welfare Fund for the project to build a high-speed railway between Moscow and St. Petersburg for 93 billion rubles. The bank reported that it could attract it in the spring and a government order has already been issued.

https://www.moscowtimes.ru/2025/04/25/update-1-vtb-mozhet-poluchit-letom-iz-fnb-200-mlrd-r-na-ust-lugu-a-vesnoy-93-mlrd-r-na-vsm-a162032

They need a lot more money or the bank will go bankrupt.

15,179 posted on 04/26/2025 12:34:04 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 15178 | View Replies]

VTB Bank’s capital deficit is 1.7 trillion rubles, head of the bank Andrey Kostin!

https://www.moscowtimes.ru/2025/04/25/update-1-vtb-rassmatrivaet-vse-vozmozhnye-istochniki-popolneniya-kapitala-vklyuchaya-dopemissiyu-a162038


15,180 posted on 04/26/2025 12:37:17 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 15179 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 15,141-15,16015,161-15,18015,181-15,200 ... 21,081-21,088 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson