Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

To: PIF
France is boosting arms production to supply Ukraine, with KNDS increasing output of Caesar howitzers and other weapons critical to Ukraine’s defense against Russia.

https://x.com/NOELreports/status/1916417845883240509

pootin did that!

15,230 posted on 04/27/2025 6:40:07 AM PDT by FtrPilot
[ Post Reply | Private Reply | To 15229 | View Replies ]


To: FtrPilot
Ukraine is producing 24 battalions worth of 155mm howitzers per year!!

The number 155mm howitzer battalions in other European armies:
🇩🇪 6
🇫🇷 6
🇵🇱 22
🇮🇹 8
🇪🇸 9
🇸🇪 2
🇳🇴 1
🇳🇱 2
🇩🇰 1
🇬🇧 1
https://x.com/noclador/status/1916135990537892130

The monthly production of the Ukrainian 155mm 2S22 Bohdana wheeled self-propelled howitzer has reached 36 units


15,239 posted on 04/27/2025 10:50:59 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 15230 | View Replies ]

To: FtrPilot
[ Post Reply | Private Reply | To 15200 | View Replies | Report Abuse]

To: JonPreston

Never trust a man wearing a bow-tie.

15,202 posted on 04/26/2025 12:04:25 PM PDT by dfwgator (Endut! Hoch Hech!)
[ Post Reply | Private Reply | To 15199 | View Replies | Report Abuse]

To: dfwgator

What misfits these people are.

15,203 posted on 04/26/2025 12:20:40 PM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 15202 | View Replies | Report Abuse]

To: BroJoeK
"It's over. You have no cards"


15,204 posted on 04/26/2025 12:22:03 PM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 15203 | View Replies | Report Abuse]

To: PIF

15,205 posted on 04/26/2025 2:56:54 PM PDT by FtrPilot
[ Post Reply | Private Reply | To 15193 | View Replies | Report Abuse]

To: gleeaikin
Russian Offensive Campaign Assessment, April 26, 2025

Gerasimov made the first official Russian acknowledgment of North Korean troop participation in Russian operations in Kursk Oblast by thanking North Korean servicemembers for their assistance in Russian efforts to push Ukrainian forces out of the region. Gerasimov stated on April 26 that North Korean forces “provided significant assistance” in pushing Ukrainian forces from Kursk Oblast, in accordance with the Russian-North Korean Treaty on Comprehensive Strategic Partnership.[12] Gerasimov commended North Korean officers and soldiers for demonstrating “professionalism” and “fortitude, courage, and heroism” during military operations in Kursk Oblast. Russian Ministry of Foreign Affairs (MFA) Spokesperson Maria Zakharova stated on April 26 that Russia would never forget its “friends” from North Korea.[13] Neither Gerasimov nor Zakharova indicated what role, if any, North Korean forces would now play in supporting Russian military operations against Ukraine.

Russia is likely preparing to systematically integrate motorcycle usage into offensive operations in Ukraine for Summer and Fall 2025, likely to offset adept Ukrainian drone capabilities. The Russian Ministry of Defense (MoD) published footage on April 26 showing likely elements of the 299th (Airborne) VDV Regiment (98th VDV Division) practicing offensive and defensive tactics on motorcycles in groups of two to three people at a Russian training ground.[22] The video indicates that the Russian military is likely developing a tactical doctrine for systematic offensive motorcycle usage and may be preparing to issue an increased number of motorcycles to Russian personnel in Ukraine. Ukrainian Kharkiv Group of Forces Spokesperson Lieutenant Colonel Pavlo Shamshyn reported that Ukrainian intelligence noted that the Russian military is training its soldiers in combat tactics with motorcycles, suggesting that Russian forces will likely increasingly integrate motorcycles into offensive operations in Ukraine in Summer and Fall 2025.[23] Shamshyn noted that motorcycles allow Russian soldiers to enhance their speed and maneuverability, which is crucial for evading Ukrainian drone strikes, but that the loud noise of the motorcycle prevents the rider from hearing approaching Ukrainian drones. ISW has observed an increased trend of Russian units conducting mechanized and combined motorized assaults and transporting infantry with motorcycles and civilian vehicles throughout the frontline as Russian command continues to adapt its tactics to offset Ukrainian drone strikes and likely to mitigate the Russian military's equipment constraints resulting from high armored vehicle losses in Summer and early Fall 2024.[24] Russian forces notably recently advanced during a motorized assault near Bahatyr comprised entirely of motorcycles and civilian vehicles.[25]

https://www.understandingwar.org/backgrounder/russian-offensive-campaign-assessment-april-26-2025

15,206 posted on 04/26/2025 11:03:14 PM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 15175 | View Replies | Report Abuse]

To: blitz128; BeauBo
The Russian economy is entering a recession, according to analysts at the Center for Macroeconomic Analysis and Short-Term Forecasting (CMASF). Due to the high key rate,[Central Bank rate of 21%] civilian production excluding the defense industry has fallen to a two-year low, while inflation continues to rise. In the first quarter of 2025, civilian production fell by 0.8% per month (seasonally adjusted), including by 1.1% in March.

The Central Bank also noted this based on the results of January-February. According to the regulator, the decline in production in the manufacturing industry “is mainly due to the production of consumer goods.” As a result, civilian production in March fell to a minimum since April 2023. “We can talk about a transition to a recession,” the experts noted.

https://t.me/bankrollo/41626

15,207 posted on 04/26/2025 11:32:03 PM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 15185 | View Replies | Report Abuse]

To: AdmSmith; blitz128

The Russian Defense sector is not growing anymore, and the contraction in non-Defense sectors is accelerating. “Locking up”, is how one analyst described it.

Harder choices ahead for Kremlin policy makers, if the war goes on. Hard recession, or inflationary money printing binge. They typically try to not go all in on one approach, so I expect the, to expand the money supply to moderate the recession rather than aggressively reverse it to high growth.

15,208 posted on 04/27/2025 1:36:04 AM PDT by BeauBo
[ Post Reply | Private Reply | To 15207 | View Replies | Report Abuse]

To: gleeaikin; PIF; GBA; blitz128; FtrPilot; BeauBo; USA-FRANCE; marcusmaximus; ETCM; SpeedyInTexas; ...
Recession!
In Russia, industry has entered recession. (red and blue)
Civilian production output (orange) has fallen to a 2023 minimum

A slowdown in growth rates, and in some places a decline, is observed even in industries related to military production:
- production of finished metal products
- production of electrical equipment
- production of electronics
- production of machinery and equipment

https://bsky.app/profile/evgen-istrebin.bsky.social/post/3lnqdbrenls2s

sources: https://www.moscowtimes.ru/2025/04/26/mozhno-govorit-o-perehode-k-retsessii-vipusk-grazhdanskoi-produktsii-upal-do-minimuma-za-dva-goda-a162170

http://www.forecast.ru/_ARCHIVE/Analitics/PROM/2025/PR-OTR_2025-04-24.pdf

15,209 posted on 04/27/2025 2:58:07 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 15207 | View Replies | Report Abuse]

To: AdmSmith

Nice coping propaganda, next step is to announce actually Calvary units to eliminate the “noise” issue.

If the “motorcycle units” make it to the front, supplying them with such mundane items like food, water, and ammunition would seem an obvious problem.

15,210 posted on 04/27/2025 4:57:00 AM PDT by blitz128
[ Post Reply | Private Reply | To 15206 | View Replies | Report Abuse]

To: AdmSmith

Just simply declare GDP growth of 5% and all is well😎

15,211 posted on 04/27/2025 4:57:58 AM PDT by blitz128
[ Post Reply | Private Reply | To 15207 | View Replies | Report Abuse]

To: blitz128
Just simply declare GDP growth of 5% and all is well😎

You mean like in China?
15,212 posted on 04/27/2025 5:07:07 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 15211 | View Replies | Report Abuse]

To: blitz128
Russian motorcycle assault across the mine field

https://x.com/bayraktar_1love/status/1916466998919233826


15,213 posted on 04/27/2025 5:27:26 AM PDT by FtrPilot
[ Post Reply | Private Reply | To 15210 | View Replies | Report Abuse]

To: PIF
Russia's ruling party United Russia reported the delivery of aid in the form of toilet paper to victims of the explosions at the 51st Arsenal east of Moscow.

https://x.com/bayraktar_1love/status/1916453844138991905


15,214 posted on 04/27/2025 5:32:22 AM PDT by FtrPilot
[ Post Reply | Private Reply | To 15213 | View Replies | Report Abuse]

To: FtrPilot
German authorities say they have arrested two people suspected of spying for Russia. The suspects, identified as German-Russian nationals, are accused of scouting targets for potential attacks, including U.S. military facilities in Germany, the Federal Public Prosecutor General for Karlsruhe said in a statement released Thursday.

The individuals — identified by the German prosecutor as Dieter S. and Alexander J. — allegedly have ties to a Russian intelligence service and are accused of gathering information about potential targets for sabotage operations.

Dieter S. is accused of being in contact with a person connected to a Russian secret service since October 2023, discussing plans for attacks on military infrastructure and industrial sites in Germany. He reportedly scouted out some of the targeted sites in person, gathering photos and videos. The detainees also scoped out potential targets for attacks, including facilities of the U.S. Army in Germany, the prosecutor said.

Politicians have called for a decisive response to the threat posed by Russian agents operating in Germany. Konstantin von Notz, the Green Party deputy leader and head of the intelligence control committee in the Bundestag, Germany's parliament, said a reaction would be necessary if the allegations are proven true. The arrests in Bavaria echoed incidents in Poland in March 2023, where authorities said they had dismantled a Russian spy network that was aiming to sabotage Western arms deliveries to Ukraine.

https://www.cbsnews.com/news/germany-russia-spies-us-military-ukraine-war-espionage-europe-nato/

15,215 posted on 04/27/2025 5:33:19 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 15213 | View Replies | Report Abuse]

To: FtrPilot

Yoy forgot to end the post with LOL!
;-)

15,216 posted on 04/27/2025 5:34:29 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 15214 | View Replies | Report Abuse]

To: AdmSmith
Norwegian "NASAMS" air defense system in service with the Ukrainian Armed Forces

https://x.com/bayraktar_1love/status/1916446736286961941


15,217 posted on 04/27/2025 5:39:16 AM PDT by FtrPilot
[ Post Reply | Private Reply | To 15215 | View Replies | Report Abuse]

To: blitz128

another obvious problem is dodging cluster munitions ...

15,218 posted on 04/27/2025 5:40:30 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 15210 | View Replies | Report Abuse]

To: FtrPilot

Wow! The victims will feel much better now with one roll for each victim.

15,219 posted on 04/27/2025 5:43:16 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 15214 | View Replies | Report Abuse]

To: AdmSmith
OK...LOL

My bad.

15,220 posted on 04/27/2025 5:46:56 AM PDT by FtrPilot
[ Post Reply | Private Reply | To 15216 | View Replies | Report Abuse]

To: PIF; blitz128
🍈

The illegal invasion is dangerous to Americans, not Putin


15,221 posted on 04/27/2025 5:58:13 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 15201 | View Replies | Report Abuse]

To: FtrPilot

Reporting From Ukraine:
https://www.youtube.com/@RFU/videos

The complete transcript.

[ 1 Shot = 100 Targets! New British High-Frequency Weapon Wastes Years of Russian Drone Development ]

Today [ Apr 26, 8 pm ], there are a lot of interesting updates from Ukraine. Here, as Russian drone swarms grow larger and more complex, the UK has unveiled a weapon designed to stop them in their tracks in mass. Named the Rapid Destroyer, this new system, with battlefield testing on the horizon, may soon give Ukraine a game-changing tool to level the playing field.

Diplomatic relations between the United Kingdom and Ukraine are likely the best foreign relations Ukraine has with any European country, as the UK was the first country to provide military aid to Ukraine at the very start of the war.

Additionally, the current Ukrainian ambassador to the UK is Valeri Zaluzhny, the former chief of staff of the Ukrainian army, whose military expertise is critical for the continued improvement of military cooperation and exchange of intelligence between the two countries. Military technology between the UK and Ukraine is likely already being exchanged, with the British conducting tests with new laser weapons right before the same technology made an appearance in Ukraine.

Recently, the United Kingdom developed a weapon that could potentially neutralize the drone threat prevalent in Ukraine. This new electronic warfare system Rapid Destroyer can take out entire drone swarms in a single charge.

Unlike regular electronic warfare systems that only disrupt the connection to the operator and disorient the drones’ navigation systems, the new British system relies on high-frequency radio waves to disrupt and destroy the electronic components within the drones, causing them to malfunction and crash. The system can take out dozens of incoming drones at a time, making it highly suited to counteract large-scale Russian drone strikes.

In live trials, the system neutralized a swarm of 100 small quadcopters with near-instant effect. The Rapid Destroyer has demonstrated an effective engagement range of approximately 1 kilometer, with further development underway to extend its range and effectiveness.

An extended range would undoubtedly be needed to solidify its role as an effective system against drones in a layered air defense network. The UK Ministry of Defence highlighted the system’s low cost per engagement, estimated at just 10 cents per shot, making it a compelling alternative to missile-based or other hard-kill defenses that can cost thousands of dollars per use.

On top of that, the extensive targeting capability of Rapid Destroyer can simultaneously destroy and disable huge drone swarms with a single charge, only increasing its cost-effective nature. While production costs are unknown, the low operating cost would make Rapid Destroyer an extremely valuable asset if deployed in large numbers, which could offset the shorter range.

Lastly, the system is mounted on a flatbed truck, allowing for high mobility to quickly respond to incoming threats and withdraw before being targeted, though its substantial power requirements necessitate a robust energy source.

With the high likelihood of close cooperation and technology sharing between Ukraine and the UK, this system could significantly reinforce the Ukrainian air defense network, providing a powerful additional layer, even at shorter ranges.

During long-range strikes, Russians often attempt to target one point in Ukraine’s air defenses, to overload and exhaust Ukrainian capabilities, and allow subsequent strikes to get through. Rapid Destroyers could quickly and efficiently neutralize these initial drone swarms, allowing other Ukrainian air defense systems to preserve air missiles and ammunition to shoot down higher-threat Russian ballistic and cruise missiles.

Overall, there is a high likelihood that this technology will soon appear in Ukraine as well, as Ukrainian engineers will strive to develop and produce domestic variants of Rapid Destroyer on a large scale, if proven effective at countering Russian drones. Given Ukraine’s deep, hard-earned expertise in countering drone warfare, incorporating systems like the Rapid Destroyer into their arsenal could significantly enhance their defensive capabilities.

Furthermore, a key incentive for technology sharing between Western allies and Ukraine lies in the potential for real-world feedback. Ukrainian forces are already providing invaluable battlefield data and performance evaluations to Western allies, which are otherwise difficult to replicate in testing environments.

These kinds of practical insights will enable designers and engineers in the West to rapidly iterate and improve on their existing weapon systems, strengthening defense capabilities in Ukraine and across the whole of NATO, while reinforcing the collaborative nature of modern warfare technology and development.

https://www.youtube.com/watch?v=6vsSRcGcXAA

15,222 posted on 04/27/2025 5:58:17 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 15217 | View Replies | Report Abuse]

To: PIF

A lot of effort to make it seem like motorcycle Calvary is planned and effective😂

15,223 posted on 04/27/2025 6:00:21 AM PDT by blitz128
[ Post Reply | Private Reply | To 15218 | View Replies | Report Abuse]

To: blitz128
🤬 This is what "Russian World" looks like…

https://x.com/UkrReview/status/1916390419400622560


15,224 posted on 04/27/2025 6:11:00 AM PDT by FtrPilot
[ Post Reply | Private Reply | To 15223 | View Replies | Report Abuse]

To: LowIQ
🍈

This is dangerous to Americans, not Putin


15,225 posted on 04/27/2025 6:11:20 AM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 15223 | View Replies | Report Abuse]

To: BeauBo
Ukrainian factories are reportedly producing up to 36 2S22 Bohdana 155mm self-propelled artillery systems every month.

That figure represents a massive increase in Ukrainian defense production capabilities, making the Bohdana one of the most widely produced SPHs in the world.

https://x.com/Osinttechnical/status/1916289653038031139

Send more artillery!

15,226 posted on 04/27/2025 6:26:20 AM PDT by FtrPilot
[ Post Reply | Private Reply | To 15224 | View Replies | Report Abuse]

To: PIF
Who was behind the attack in Kashmir?

23APR2025 In Pahalgam, Kashmir, tourists came under attack from gunmen 22APR2025 who emerged from a nearby forest. The men armed with automatic rifles shot at least 26 tourists dead and injured several others. All those killed were men. The Resistance Front (TRF), a little-known armed group that emerged in the region in 2019, claimed responsibility for the attack.

The name The Resistance Front is a break from traditional rebel groups in Kashmir, most of which bear Islamic names. This, Indian intelligence agencies believe, was aimed at projecting “a neutral character, with ‘resistance’ in name focused on Kashmiri nationalism”, said a police officer, who has worked on cases involving armed groups for nearly a decade, requesting anonymity.

However, Indian officials have consistently maintained that, in reality, TRF is an offshoot — or just a front — of the Lashkar-e-Taiba, a Pakistan-based armed group. India says Pakistan supports the armed rebellion in Kashmir, a charge denied by Islamabad. Pakistan says it provides only diplomatic and moral support to the Kashmiri people. It also condemned the attack on tourists in Pahalgam. Some Indian officials said they believe Tuesday's attack may actually have been the handiwork of the Lashkar-e-Taiba, with TRF fronting responsibility to muddy India's investigations into the killings.
https://www.aljazeera.com/news/2025/4/23/what-is-the-resistance-front-the-group-behind-the-deadly-kashmir-attack

27 APR2025 The Resistance Front unequivocally denies any involvement in Pahalgam incident. Any attribution of this
act to TRF is false, hasty, & part of an orchestrated campaign to malign Kashmiri resistance,” its statement alleged. “Shortly after the Pahalgam attack, a brief and unauthorised message was posted from one of our digital platforms. After an internal audit, we have reason to believe it was the result of a coordinated cyber intrusion - a familiar tactic in Indian state's digital warfare arsenal,” it further claimed.
http://timesofindia.indiatimes.com/articleshow/120654688.cms

26APR2025 Pakistan called on Saturday for a “neutral” investigation into the killings of mostly Indian tourists in Kashmir that New Delhi has blamed on Islamabad, saying it was willing to cooperate and favoured peace. “Pakistan is fully prepared to cooperate with any neutral investigators to ensure that the truth is uncovered and justice is served,” said Pakistan's interior minister, Mohsin Naqvi.
https://www.reuters.com/world/india/india-pakistan-exchange-gunfire-2nd-day-ties-plummet-after-attack-2025-04-26/

The attack was similar to the 7OCT2023 attack against Israel, and that was planned by Iran and Russia. Since Russia is having problems with its war in Ukraine, they want more conflicts elsewhere to reduce the focus on Ukraine. A kinetic operation between India and Pakistan would not be so stupid for the Moscovites. Since they have infiltration in most terrorist groups, they have probably been planning this for some time.

It could have been done via Hamas or via Russian members of Lashkar-e-Taiba either with the consent of the TRF leadership or without their knowledge.

In this case I don't think Pakistan had any prior knowledge of what was going to happen, but ISI is not a truth teller and has used and trained terrorists against India before. Nor should you believe what the Indians say because RAW has been trained by the KGB.

15,227 posted on 04/27/2025 6:27:40 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 15222 | View Replies | Report Abuse]


15,228 posted on 04/27/2025 6:32:59 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 15222 | View Replies | Report Abuse]

To: PIF

15,229 posted on 04/27/2025 6:33:57 AM PDT by PIF (They came for me and mine ... now its your turn)
[ Post Reply | Private Reply | To 15228 | View Replies | Report Abuse]

To: PIF
France is boosting arms production to supply Ukraine, with KNDS increasing output of Caesar howitzers and other weapons critical to Ukraine’s defense against Russia.

https://x.com/NOELreports/status/1916417845883240509

pootin did that!

15,230 posted on 04/27/2025 6:40:07 AM PDT by FtrPilot
[ Post Reply | Private Reply | To 15229 | View Replies | Report Abuse]

To: PIF

It is interesting how myopic some people can appear. Our constitution demands that we protect ourselves from all enemies both foreign and domestic.

Much like the earlier talk of how sending munitions to Ukraine somehow made our southern border less secure or caused homelessness with our veterans.

15,231 posted on 04/27/2025 7:02:54 AM PDT by blitz128
[ Post Reply | Private Reply | To 15228 | View Replies | Report Abuse]

To: PIF

15,232 posted on 04/27/2025 7:52:43 AM PDT by JonPreston ( ✌ ☮️ )

15,241 posted on 04/27/2025 12:12:45 PM PDT by JonPreston ( ✌ ☮️ )
[ Post Reply | Private Reply | To 15230 | View Replies ]

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article


FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson