Free Republic
Browse · Search
Smoky Backroom
Topics · Post Article

Skip to comments.

Dinosaur Shocker (YEC say dinosaur soft tissue couldn’t possibly survive millions of years)
Smithsonian Magazine ^ | May 1, 2006 | Helen Fields

Posted on 05/01/2006 8:29:14 AM PDT by SirLinksalot

Dinosaur Shocker

By Helen Fields

Neatly dressed in blue Capri pants and a sleeveless top, long hair flowing over her bare shoulders, Mary Schweitzer sits at a microscope in a dim lab, her face lit only by a glowing computer screen showing a network of thin, branching vessels. That’s right, blood vessels. From a dinosaur. “Ho-ho-ho, I am excite-e-e-e-d,” she chuckles. “I am, like, really excited.”

After 68 million years in the ground, a Tyrannosaurus rex found in Montana was dug up, its leg bone was broken in pieces, and fragments were dissolved in acid in Schweitzer’s laboratory at North Carolina State University in Raleigh. “Cool beans,” she says, looking at the image on the screen.

It was big news indeed last year when Schweitzer announced she had discovered blood vessels and structures that looked like whole cells inside that T. rex bone—the first observation of its kind. The finding amazed colleagues, who had never imagined that even a trace of still-soft dinosaur tissue could survive. After all, as any textbook will tell you, when an animal dies, soft tissues such as blood vessels, muscle and skin decay and disappear over time, while hard tissues like bone may gradually acquire minerals from the environment and become fossils. Schweitzer, one of the first scientists to use the tools of modern cell biology to study dinosaurs, has upended the conventional wisdom by showing that some rock-hard fossils tens of millions of years old may have remnants of soft tissues hidden away in their interiors. “The reason it hasn’t been discovered before is no right-thinking paleontologist would do what Mary did with her specimens. We don’t go to all this effort to dig this stuff out of the ground to then destroy it in acid,” says dinosaur paleontologist Thomas Holtz Jr., of the University of Maryland. “It’s great science.” The observations could shed new light on how dinosaurs evolved and how their muscles and blood vessels worked. And the new findings might help settle a long-running debate about whether dinosaurs were warmblooded, coldblooded—or both.

Meanwhile, Schweitzer’s research has been hijacked by “young earth” creationists, who insist that dinosaur soft tissue couldn’t possibly survive millions of years. They claim her discoveries support their belief, based on their interpretation of Genesis, that the earth is only a few thousand years old. Of course, it’s not unusual for a paleontologist to differ with creationists. But when creationists misrepresent Schweitzer’s data, she takes it personally: she describes herself as “a complete and total Christian.” On a shelf in her office is a plaque bearing an Old Testament verse: “For I know the plans I have for you,” declares the Lord, “plans to prosper you and not to harm you, plans to give you hope and a future.”

It may be that Schweitzer’s unorthodox approach to paleontology can be traced to her roundabout career path. Growing up in Helena, Montana, she went through a phase when, like many kids, she was fascinated by dinosaurs. In fact, at age 5 she announced she was going to be a paleontologist. But first she got a college degree in communicative disorders, married, had three children and briefly taught remedial biology to high schoolers. In 1989, a dozen years after she graduated from college, she sat in on a class at Montana State University taught by paleontologist Jack Horner, of the Museum of the Rockies, now an affiliate of the Smithsonian Institution. The lectures reignited her passion for dinosaurs. Soon after, she talked her way into a volunteer position in Horner’s lab and began to pursue a doctorate in paleontology.

She initially thought she would study how the microscopic structure of dinosaur bones differs depending on how much the animal weighs. But then came the incident with the red spots.

AdvertisementIn 1991, Schweitzer was trying to study thin slices of bones from a 65-million-year-old T. rex. She was having a hard time getting the slices to stick to a glass slide, so she sought help from a molecular biologist at the university. The biologist, Gayle Callis, happened to take the slides to a veterinary conference, where she set up the ancient samples for others to look at. One of the vets went up to Callis and said, “Do you know you have red blood cells in that bone?” Sure enough, under a microscope, it appeared that the bone was filled with red disks. Later, Schweitzer recalls, “I looked at this and I looked at this and I thought, this can’t be. Red blood cells don’t preserve.”

Schweitzer showed the slide to Horner. “When she first found the red-blood-cell-looking structures, I said, Yep, that’s what they look like,” her mentor recalls. He thought it was possible they were red blood cells, but he gave her some advice: “Now see if you can find some evidence to show that that’s not what they are.”

What she found instead was evidence of heme in the bones—additional support for the idea that they were red blood cells. Heme is a part of hemoglobin, the protein that carries oxygen in the blood and gives red blood cells their color. “It got me real curious as to exceptional preservation,” she says. If particles of that one dinosaur were able to hang around for 65 million years, maybe the textbooks were wrong about fossilization.

Schweitzer tends to be self-deprecating, claiming to be hopeless at computers, lab work and talking to strangers. But colleagues admire her, saying she’s determined and hard-working and has mastered a number of complex laboratory techniques that are beyond the skills of most paleontologists. And asking unusual questions took a lot of nerve. “If you point her in a direction and say, don’t go that way, she’s the kind of person who’ll say, Why?—and she goes and tests it herself,” says Gregory Erickson, a paleobiologist at Florida State University. Schweitzer takes risks, says Karen Chin, a University of Colorado paleontologist. “It could be a big payoff or it could just be kind of a ho-hum research project.”

In 2000, Bob Harmon, a field crew chief from the Museum of the Rockies, was eating his lunch in a remote Montana canyon when he looked up and saw a bone sticking out of a rock wall. That bone turned out to be part of what may be the best preserved T. rex in the world. Over the next three summers, workers chipped away at the dinosaur, gradually removing it from the cliff face. They called it B. rex in Harmon’s honor and nicknamed it Bob. In 2001, they encased a section of the dinosaur and the surrounding dirt in plaster to protect it. The package weighed more than 2,000 pounds, which turned out to be just above their helicopter’s capacity, so they split it in half. One of B. rex’s leg bones was broken into two big pieces and several fragments—just what Schweitzer needed for her micro-scale explorations.

It turned out Bob had been misnamed. “It’s a girl and she’s pregnant,” Schweitzer recalls telling her lab technician when she looked at the fragments. On the hollow inside surface of the femur, Schweitzer had found scraps of bone that gave a surprising amount of information about the dinosaur that made them. Bones may seem as steady as stone, but they’re actually constantly in flux. Pregnant women use calcium from their bones to build the skeleton of a developing fetus. Before female birds start to lay eggs, they form a calcium-rich structure called medullary bone on the inside of their leg and other bones; they draw on it during the breeding season to make eggshells. Schweitzer had studied birds, so she knew about medullary bone, and that’s what she figured she was seeing in that T. rex specimen.

Most paleontologists now agree that birds are the dinosaurs’ closest living relatives. In fact, they say that birds are dinosaurs—colorful, incredibly diverse, cute little feathered dinosaurs. The theropod of the Jurassic forests lives on in the goldfinch visiting the backyard feeder, the toucans of the tropics and the ostriches loping across the African savanna.

To understand her dinosaur bone, Schweitzer turned to two of the most primitive living birds: ostriches and emus. In the summer of 2004, she asked several ostrich breeders for female bones. A farmer called, months later. “Y’all still need that lady ostrich?” The dead bird had been in the farmer’s backhoe bucket for several days in the North Carolina heat. Schweitzer and two colleagues collected a leg from the fragrant carcass and drove it back to Raleigh.

AdvertisementAs far as anyone can tell, Schweitzer was right: Bob the dinosaur really did have a store of medullary bone when she died. A paper published in Science last June presents microscope pictures of medullary bone from ostrich and emu side by side with dinosaur bone, showing near-identical features.

In the course of testing a B. rex bone fragment further, Schweitzer asked her lab technician, Jennifer Wittmeyer, to put it in weak acid, which slowly dissolves bone, including fossilized bone—but not soft tissues. One Friday night in January 2004, Wittmeyer was in the lab as usual. She took out a fossil chip that had been in the acid for three days and put it under the microscope to take a picture. “[The chip] was curved so much, I couldn’t get it in focus,” Wittmeyer recalls. She used forceps to flatten it. “My forceps kind of sunk into it, made a little indentation and it curled back up. I was like, stop it!” Finally, through her irritation, she realized what she had: a fragment of dinosaur soft tissue left behind when the mineral bone around it had dissolved. Suddenly Schweitzer and Wittmeyer were dealing with something no one else had ever seen. For a couple of weeks, Wittmeyer said, it was like Christmas every day.

In the lab, Wittmeyer now takes out a dish with six compartments, each holding a little brown dab of tissue in clear liquid, and puts it under the microscope lens. Inside each specimen is a fine network of almost-clear branching vessels—the tissue of a female Tyrannosaurus rex that strode through the forests 68 million years ago, preparing to lay eggs. Close up, the blood vessels from that T. rex and her ostrich cousins look remarkably alike. Inside the dinosaur vessels are things Schweitzer diplomatically calls “round microstructures” in the journal article, out of an abundance of scientific caution, but they are red and round, and she and other scientists suspect that they are red blood cells.

Of course, what everyone wants to know is whether DNA might be lurking in that tissue. Wittmeyer, from much experience with the press since the discovery, calls this “the awful question”—whether Schweitzer’s work is paving the road to a real-life version of science fiction’s Jurassic Park, where dinosaurs were regenerated from DNA preserved in amber. But DNA, which carries the genetic script for an animal, is a very fragile molecule. It’s also ridiculously hard to study because it is so easily contaminated with modern biological material, such as microbes or skin cells, while buried or after being dug up. Instead, Schweitzer has been testing her dinosaur tissue samples for proteins, which are a bit hardier and more readily distinguished from contaminants. Specifically, she’s been looking for collagen, elastin and hemoglobin. Collagen makes up much of the bone scaffolding, elastin is wrapped around blood vessels and hemoglobin carries oxygen inside red blood cells.

Because the chemical makeup of proteins changes through evolution, scientists can study protein sequences to learn more about how dinosaurs evolved. And because proteins do all the work in the body, studying them could someday help scientists understand dinosaur physiology—how their muscles and blood vessels worked, for example.

Proteins are much too tiny to pick out with a microscope. To look for them, Schweitzer uses antibodies, immune system molecules that recognize and bind to specific sections of proteins. Schweitzer and Wittmeyer have been using antibodies to chicken collagen, cow elastin and ostrich hemoglobin to search for similar molecules in the dinosaur tissue. At an October 2005 paleontology conference, Schweitzer presented preliminary evidence that she has detected real dinosaur proteins in her specimens.

Further discoveries in the past year have shown that the discovery of soft tissue in B. rex wasn’t just a fluke. Schweitzer and Wittmeyer have now found probable blood vessels, bone-building cells and connective tissue in another T. rex, in a theropod from Argentina and in a 300,000-year-old woolly mammoth fossil. Schweitzer’s work is “showing us we really don’t understand decay,” Holtz says. “There’s a lot of really basic stuff in nature that people just make assumptions about.”

young-earth creationists also see Schweitzer’s work as revolutionary, but in an entirely different way. They first seized upon Schweitzer’s work after she wrote an article for the popular science magazine Earth in 1997 about possible red blood cells in her dinosaur specimens. Creation magazine claimed that Schweitzer’s research was “powerful testimony against the whole idea of dinosaurs living millions of years ago. It speaks volumes for the Bible’s account of a recent creation.”

This drives Schweitzer crazy. Geologists have established that the Hell Creek Formation, where B. rex was found, is 68 million years old, and so are the bones buried in it. She’s horrified that some Christians accuse her of hiding the true meaning of her data. “They treat you really bad,” she says. “They twist your words and they manipulate your data.” For her, science and religion represent two different ways of looking at the world; invoking the hand of God to explain natural phenomena breaks the rules of science. After all, she says, what God asks is faith, not evidence. “If you have all this evidence and proof positive that God exists, you don’t need faith. I think he kind of designed it so that we’d never be able to prove his existence. And I think that’s really cool.”

By definition, there is a lot that scientists don’t know, because the whole point of science is to explore the unknown. By being clear that scientists haven’t explained everything, Schweitzer leaves room for other explanations. “I think that we’re always wise to leave certain doors open,” she says.

But schweitzer’s interest in the long-term preservation of molecules and cells does have an otherworldly dimension: she’s collaborating with NASA scientists on the search for evidence of possible past life on Mars, Saturn’s moon Titan, and other heavenly bodies. (Scientists announced this spring, for instance, that Saturn’s tiny moon Enceladus appears to have liquid water, a probable precondition for life.)

Astrobiology is one of the wackier branches of biology, dealing in life that might or might not exist and might or might not take any recognizable form. “For almost everybody who works on NASA stuff, they are just in hog heaven, working on astrobiology questions,” Schweitzer says. Her NASA research involves using antibodies to probe for signs of life in unexpected places. “For me, it’s the means to an end. I really want to know about my dinosaurs.”

AdvertisementTo that purpose, Schweitzer, with Wittmeyer, spends hours in front of microscopes in dark rooms. To a fourth-generation Montanan, even the relatively laid-back Raleigh area is a big city. She reminisces wistfully about scouting for field sites on horseback in Montana. “Paleontology by microscope is not that fun,” she says. “I’d much rather be out tromping around.”

“My eyeballs are just absolutely fried,” Schweitzer says after hours of gazing through the microscope’s eyepieces at glowing vessels and blobs. You could call it the price she pays for not being typical.


TOPICS: Heated Discussion
KEYWORDS: crevolist; dinosaur; dinosaurs; evolution; godsgravesglyphs; maryschweitzer; paleontology; shocker
Navigation: use the links below to view more comments.
first previous 1-20 ... 541-560, 561-580, 581-600 ... 1,701 next last
To: GourmetDan
Your question regarding assumptions (in this case for radiocarbon dating) is well addressed in the folowing website from Biblical Chronologist:

Is radiocarbon dating based on assumptions?

561 posted on 05/02/2006 9:23:14 AM PDT by Coyoteman (Creationists know Jack Chick about evolution.)
[ Post Reply | Private Reply | To 555 | View Replies]

To: ahayes

(That's it! I'm confiscating your cat for excessive cuteness!)

Isn't she! You should see her kittens! She only had two, but they are cutties! I'll download some pictures later and post then too!


562 posted on 05/02/2006 9:23:58 AM PDT by Conservative Texan Mom (Some people say I'm stubborn, when it's usually just that I'm right.)
[ Post Reply | Private Reply | To 460 | View Replies]

To: Conservative Texan Mom
OK. I 'get' that this was a Science-Dino-Thread that has been hijacked by (among others) Young-Earth-Empty-Head-Creationists.

But for the life of me I can't figure out where your posts about your farm animals come in :>0

Perhaps you meant to exchange private messages with your interlocutor on the subject...

563 posted on 05/02/2006 9:24:58 AM PDT by Al Simmons (Four-time Bush Voter 1994-2004!!!!!!!!!!!!)
[ Post Reply | Private Reply | To 560 | View Replies]

To: Liberal Classic

I love that!

Apparently God created those dinosaurs with large, meat-tearing fangs because he knew that they would give up vegetarianism due to mankind's sins! Never mind that they wouldn't work very well on plants - it wouldn't be long until they weren't eating plants, anyway!


564 posted on 05/02/2006 9:33:14 AM PDT by 2nsdammit (By definition it's hard to get suicide bombers with experience.)
[ Post Reply | Private Reply | To 559 | View Replies]

To: Right Wing Professor
Is it cheating to run a Blast job through NCBI's website? :)

Just for fun I ran the same human sequence against the Rhesus monkey.

>gb|AANU01283423.1| Macaca mulatta 1099214608000, whole genome shotgun sequence
Length=19382

 Score =  446 bits (241),  Expect = 4e-123
 Identities = 266/278 (95%), Gaps = 1/278 (0%)
 Strand=Plus/Minus

Query  1      CCAGCGTGCGTGTTCCTGTGCCTGTGGGAGCTGGCTATCTCAGCGGGTGGGTGCCTCACC  60
              |||||||||||||| ||||||||||||||||||||  |||||| ||||||||||||||||
Sbjct  12573  CCAGCGTGCGTGTT-CTGTGCCTGTGGGAGCTGGCCGTCTCAGTGGGTGGGTGCCTCACC  12515

Query  61     TTGCCCTGTCCTCCCCCTCGACCTCACTCTCCTTCCTTCTCATCCCCCTCCAGATTGACA  120
               |||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||
Sbjct  12514  CTGCCCTGTCCTCCCCCTCGACCTCACTCTCCTTCCTTCTCATTCTCCTCCAGATTGACA  12455

Query  121    AGTATCTCTATGCCATGCGGCTCTCCGATGAAACTCTCATAGATATCATGACTCGCTTCA  180
              |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||
Sbjct  12454  AGTATCTCTATGCCATGCGGCTGTCCGATGAAACTCTCATAGATATCATGACTCGCTTCA  12395

Query  181    GGAAGGAGATGAAGAATGGCCTCTCCCGGGATTTTAATCCAACAGCCACAGTCAAGATGT  240
               |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  12394  AGAAGGAAATGAAGAATGGCCTCTCCCGGGATTTTAATCCAACAGCCACAGTCAAGATGT  12335

Query  241    TGCCAACATTCGTAAGGTCCATTCCTGATGGCTCTGGT  278
              |||||||||||||||| |||||||| ||||||||||||
Sbjct  12334  TGCCAACATTCGTAAGATCCATTCCCGATGGCTCTGGT  12297

Whereas the chimp sequence was 99% the same as a human, the monkey is 95% same as a human.

Furthermore, the two base pairs in the chimp genome that were different from human (TA->GC along the first row, query is human, subject is monkey) are the same in the monkey and chimp. Chimp and monkey have GC, human has TA. However, they monkey has further changes that aren't in common with either chimp or human. So, the human and chimp share many of the same genes, and they are both slightly different than the monkey. There's a progression. Chimp is just a little different than human, monkey is a little more far removed from human. Etc. Just what one would expect from common ancestry.

The was already a great deal geological and fossil evidence in support of evolutionary theory. Comparative genomics has only strengthened the theory.

565 posted on 05/02/2006 9:33:59 AM PDT by Liberal Classic (No better friend, no worse enemy. Semper Fi.)
[ Post Reply | Private Reply | To 550 | View Replies]

To: GourmetDan
Discussed here.

Changing radioactive decay rates would leave measurable traces; such traces have not been observed. Also check with the Lyman Alpha Forest; it would be different were things light the speed of light changing.

566 posted on 05/02/2006 9:35:28 AM PDT by Doctor Stochastic (Vegetabilisch = chaotisch ist der Charakter der Modernen. - Friedrich Schlegel)
[ Post Reply | Private Reply | To 555 | View Replies]

To: 2nsdammit

Kind of causes one to question the idea of free will, doesn't it?


567 posted on 05/02/2006 9:35:59 AM PDT by Liberal Classic (No better friend, no worse enemy. Semper Fi.)
[ Post Reply | Private Reply | To 564 | View Replies]

To: GourmetDan
1. The amount of 'daughter' element present initially.

Nope. Not necessary. For most of the daughter elements, there are multiple isotopes. So, for example, in a zircon, lead-204, which is not a product of radioactive decay, can be used as an indicator of how lead was present initially. In addition, since U-235 and U-238 give independent dates, the consistency of the two can be used as an additional check.

2. That the system has been sealed since it formed.

In zircon dating, this only happens if the zircon has been significantly heated and/or radiation damaged (i.e. it's already very old). Heating/damage is often evident; and it causes the differential escape of the more volatile lead. So the result is an incorrectly 'young' age for the crystal. That zircons may sometimes actually be older than they're dated is no help to a YEC!

3. That the radioactive decay rate has always been the same.

I already posted a link on the constancy of the fundamental physical constants. That is an experimental fact, not an assumption. Moreover, there are all sorts of other reasons why radioisotope ratios rule out a 6000 year old earth; most spectacularly, the fact that if all that decay had occured within a short length of time, as Humphreys and his pals propose, the heat evolved would have brought the earth to a temperature of several thousand degrees.

568 posted on 05/02/2006 9:37:37 AM PDT by Right Wing Professor
[ Post Reply | Private Reply | To 555 | View Replies]

To: Conservative Texan Mom
Our dog (a lab mutt) was abandoned before we got her. She wouldn't run away for anything. We could leave the front door wide open, and she wouldn't go anywhere. We've had her for some years now, and she's really gained in confidence. She's a part of our family now, and even guards our cats against others in the neighborhood. If I hear a cat fight I just let her outside and she breaks it up real quick. I love dogs.
569 posted on 05/02/2006 9:40:56 AM PDT by Liberal Classic (No better friend, no worse enemy. Semper Fi.)
[ Post Reply | Private Reply | To 560 | View Replies]

To: Al Simmons

I'd rather that a thread get hijacked by talk about kittens than discussion of the Holocaust as a consequence of evolutionary theory.


570 posted on 05/02/2006 9:45:16 AM PDT by Liberal Classic (No better friend, no worse enemy. Semper Fi.)
[ Post Reply | Private Reply | To 563 | View Replies]

To: Liberal Classic
Is it cheating to run a Blast job through NCBI's website?

People do much worse.

571 posted on 05/02/2006 9:46:03 AM PDT by Right Wing Professor
[ Post Reply | Private Reply | To 565 | View Replies]

To: Liberal Classic

Not to mention the inate cruelty of deliberately designing an animal with teeth which couldn't function for its intended diet, thus condemning it to potential starvation....


572 posted on 05/02/2006 9:48:26 AM PDT by 2nsdammit (By definition it's hard to get suicide bombers with experience.)
[ Post Reply | Private Reply | To 567 | View Replies]

To: Right Wing Professor

That's actually kind of funny. There are some people who really believe in hidden messages in DNA like the Bible Code.


573 posted on 05/02/2006 9:53:17 AM PDT by Liberal Classic (No better friend, no worse enemy. Semper Fi.)
[ Post Reply | Private Reply | To 571 | View Replies]

To: GourmetDan

For 1 and 2 modern dating methods can detect these variables or they may not even be relevant. For 3 we don't have any reasonable cause to think that they have changed, and evidence indicates they haven't.


574 posted on 05/02/2006 9:55:05 AM PDT by ahayes (Yes, I have a devious plot. No, you may not know what it is.)
[ Post Reply | Private Reply | To 555 | View Replies]

To: Liberal Classic; Al Simmons; Conservative Texan Mom; Elsie; Ichneumon

I think there was some small reason why some of the chit-chat on this thread got onto the talk about different animals...and why, is that necessarily a bad thing?...I dont think that it is...often threads of a serious nature, actually lighten up a bit, with some back and forth banter of a side subject, so to speak...

In between the Elsie-thons of scriptures, and Ichneumons lenghty scientific postings, we now find pictures of sweet, cute animals...Is that really aggravating?...


575 posted on 05/02/2006 9:59:38 AM PDT by andysandmikesmom
[ Post Reply | Private Reply | To 570 | View Replies]

To: Al Simmons
s'ok. This is why I try to avoid these threads. I never should have posted to begin with. Things get too heated all over an issue (evolution) that has nothing to do with religion, really.

All my fellow Christians who are adamant about "proving" a young earth or Intelligent Design should rest easy. Science doesn't seek to "disprove God", nor could it ever do so. It's an inherent, and ultimately irrational distrust of science in general that says otherwise.
576 posted on 05/02/2006 9:59:49 AM PDT by FourtySeven (47)
[ Post Reply | Private Reply | To 546 | View Replies]

To: Elsie
The verses also are an encouragement to act on faith, which is so wonderful, and encouraging just to read! I think a lot of it has to do with a person's heart, and why they want proof. This is a hard one. The heart is a tricky thing! We, as people, are often prideful in being "right". I wonder how God would respond to a request to "prove himself" if the true motive was to justify our pride. What is so hard, is recognizing that motive. It gets mixed in and meshed with a lot of emotions.

This is a side note, as it is something else that's on my heart. There are several verses that I try to keep in mind when I respond to other posters on this thread.
1 John 4:8
Whoever does not love does not know God, because God is love

I've also been thinking about 1 Corinthians 13, and what the attributes of love are.

4Love is patient, love is kind. It does not envy, it does not boast, it is not proud. 5It is not rude, it is not self-seeking, it is not easily angered, it keeps no record of wrongs. 6Love does not delight in evil but rejoices with the truth. 7It always protects, always trusts, always hopes, always perseveres.

It has occurred to me that God will hold me accountable for the manner in which I portray Him to nonbelievers. I pray each day that I will do so in a way that will please Him.

I always enjoy the verses you post.
577 posted on 05/02/2006 10:02:35 AM PDT by Conservative Texan Mom (Some people say I'm stubborn, when it's usually just that I'm right.)
[ Post Reply | Private Reply | To 471 | View Replies]

To: Liberal Classic
Here's something interesting. If you blast 'satan', you find that sequence of 5 very common amino acids appears in no known protein.

What more proof of ID do you need?

578 posted on 05/02/2006 10:05:22 AM PDT by Right Wing Professor
[ Post Reply | Private Reply | To 573 | View Replies]

To: andysandmikesmom
FIRE IN THE HOLE!


579 posted on 05/02/2006 10:05:42 AM PDT by Liberal Classic (No better friend, no worse enemy. Semper Fi.)
[ Post Reply | Private Reply | To 575 | View Replies]

To: SirLinksalot
“Ho-ho-ho, I am excite-e-e-e-d,” she chuckles. “I am, like, really excited.”

“Cool beans,” she says

It's, like, really gnarly that this, like, chick is so into, like, dissolving bones in acid and, like, looking at cool stuff under a microscope. Radical!

580 posted on 05/02/2006 10:08:10 AM PDT by MEGoody (Ye shall know the truth, and the truth shall make you free.)
[ Post Reply | Private Reply | To 1 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 541-560, 561-580, 581-600 ... 1,701 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Smoky Backroom
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson