Free Republic
Browse · Search
Smoky Backroom
Topics · Post Article

Skip to comments.

Dinosaur Shocker (YEC say dinosaur soft tissue couldn’t possibly survive millions of years)
Smithsonian Magazine ^ | May 1, 2006 | Helen Fields

Posted on 05/01/2006 8:29:14 AM PDT by SirLinksalot

Dinosaur Shocker

By Helen Fields

Neatly dressed in blue Capri pants and a sleeveless top, long hair flowing over her bare shoulders, Mary Schweitzer sits at a microscope in a dim lab, her face lit only by a glowing computer screen showing a network of thin, branching vessels. That’s right, blood vessels. From a dinosaur. “Ho-ho-ho, I am excite-e-e-e-d,” she chuckles. “I am, like, really excited.”

After 68 million years in the ground, a Tyrannosaurus rex found in Montana was dug up, its leg bone was broken in pieces, and fragments were dissolved in acid in Schweitzer’s laboratory at North Carolina State University in Raleigh. “Cool beans,” she says, looking at the image on the screen.

It was big news indeed last year when Schweitzer announced she had discovered blood vessels and structures that looked like whole cells inside that T. rex bone—the first observation of its kind. The finding amazed colleagues, who had never imagined that even a trace of still-soft dinosaur tissue could survive. After all, as any textbook will tell you, when an animal dies, soft tissues such as blood vessels, muscle and skin decay and disappear over time, while hard tissues like bone may gradually acquire minerals from the environment and become fossils. Schweitzer, one of the first scientists to use the tools of modern cell biology to study dinosaurs, has upended the conventional wisdom by showing that some rock-hard fossils tens of millions of years old may have remnants of soft tissues hidden away in their interiors. “The reason it hasn’t been discovered before is no right-thinking paleontologist would do what Mary did with her specimens. We don’t go to all this effort to dig this stuff out of the ground to then destroy it in acid,” says dinosaur paleontologist Thomas Holtz Jr., of the University of Maryland. “It’s great science.” The observations could shed new light on how dinosaurs evolved and how their muscles and blood vessels worked. And the new findings might help settle a long-running debate about whether dinosaurs were warmblooded, coldblooded—or both.

Meanwhile, Schweitzer’s research has been hijacked by “young earth” creationists, who insist that dinosaur soft tissue couldn’t possibly survive millions of years. They claim her discoveries support their belief, based on their interpretation of Genesis, that the earth is only a few thousand years old. Of course, it’s not unusual for a paleontologist to differ with creationists. But when creationists misrepresent Schweitzer’s data, she takes it personally: she describes herself as “a complete and total Christian.” On a shelf in her office is a plaque bearing an Old Testament verse: “For I know the plans I have for you,” declares the Lord, “plans to prosper you and not to harm you, plans to give you hope and a future.”

It may be that Schweitzer’s unorthodox approach to paleontology can be traced to her roundabout career path. Growing up in Helena, Montana, she went through a phase when, like many kids, she was fascinated by dinosaurs. In fact, at age 5 she announced she was going to be a paleontologist. But first she got a college degree in communicative disorders, married, had three children and briefly taught remedial biology to high schoolers. In 1989, a dozen years after she graduated from college, she sat in on a class at Montana State University taught by paleontologist Jack Horner, of the Museum of the Rockies, now an affiliate of the Smithsonian Institution. The lectures reignited her passion for dinosaurs. Soon after, she talked her way into a volunteer position in Horner’s lab and began to pursue a doctorate in paleontology.

She initially thought she would study how the microscopic structure of dinosaur bones differs depending on how much the animal weighs. But then came the incident with the red spots.

AdvertisementIn 1991, Schweitzer was trying to study thin slices of bones from a 65-million-year-old T. rex. She was having a hard time getting the slices to stick to a glass slide, so she sought help from a molecular biologist at the university. The biologist, Gayle Callis, happened to take the slides to a veterinary conference, where she set up the ancient samples for others to look at. One of the vets went up to Callis and said, “Do you know you have red blood cells in that bone?” Sure enough, under a microscope, it appeared that the bone was filled with red disks. Later, Schweitzer recalls, “I looked at this and I looked at this and I thought, this can’t be. Red blood cells don’t preserve.”

Schweitzer showed the slide to Horner. “When she first found the red-blood-cell-looking structures, I said, Yep, that’s what they look like,” her mentor recalls. He thought it was possible they were red blood cells, but he gave her some advice: “Now see if you can find some evidence to show that that’s not what they are.”

What she found instead was evidence of heme in the bones—additional support for the idea that they were red blood cells. Heme is a part of hemoglobin, the protein that carries oxygen in the blood and gives red blood cells their color. “It got me real curious as to exceptional preservation,” she says. If particles of that one dinosaur were able to hang around for 65 million years, maybe the textbooks were wrong about fossilization.

Schweitzer tends to be self-deprecating, claiming to be hopeless at computers, lab work and talking to strangers. But colleagues admire her, saying she’s determined and hard-working and has mastered a number of complex laboratory techniques that are beyond the skills of most paleontologists. And asking unusual questions took a lot of nerve. “If you point her in a direction and say, don’t go that way, she’s the kind of person who’ll say, Why?—and she goes and tests it herself,” says Gregory Erickson, a paleobiologist at Florida State University. Schweitzer takes risks, says Karen Chin, a University of Colorado paleontologist. “It could be a big payoff or it could just be kind of a ho-hum research project.”

In 2000, Bob Harmon, a field crew chief from the Museum of the Rockies, was eating his lunch in a remote Montana canyon when he looked up and saw a bone sticking out of a rock wall. That bone turned out to be part of what may be the best preserved T. rex in the world. Over the next three summers, workers chipped away at the dinosaur, gradually removing it from the cliff face. They called it B. rex in Harmon’s honor and nicknamed it Bob. In 2001, they encased a section of the dinosaur and the surrounding dirt in plaster to protect it. The package weighed more than 2,000 pounds, which turned out to be just above their helicopter’s capacity, so they split it in half. One of B. rex’s leg bones was broken into two big pieces and several fragments—just what Schweitzer needed for her micro-scale explorations.

It turned out Bob had been misnamed. “It’s a girl and she’s pregnant,” Schweitzer recalls telling her lab technician when she looked at the fragments. On the hollow inside surface of the femur, Schweitzer had found scraps of bone that gave a surprising amount of information about the dinosaur that made them. Bones may seem as steady as stone, but they’re actually constantly in flux. Pregnant women use calcium from their bones to build the skeleton of a developing fetus. Before female birds start to lay eggs, they form a calcium-rich structure called medullary bone on the inside of their leg and other bones; they draw on it during the breeding season to make eggshells. Schweitzer had studied birds, so she knew about medullary bone, and that’s what she figured she was seeing in that T. rex specimen.

Most paleontologists now agree that birds are the dinosaurs’ closest living relatives. In fact, they say that birds are dinosaurs—colorful, incredibly diverse, cute little feathered dinosaurs. The theropod of the Jurassic forests lives on in the goldfinch visiting the backyard feeder, the toucans of the tropics and the ostriches loping across the African savanna.

To understand her dinosaur bone, Schweitzer turned to two of the most primitive living birds: ostriches and emus. In the summer of 2004, she asked several ostrich breeders for female bones. A farmer called, months later. “Y’all still need that lady ostrich?” The dead bird had been in the farmer’s backhoe bucket for several days in the North Carolina heat. Schweitzer and two colleagues collected a leg from the fragrant carcass and drove it back to Raleigh.

AdvertisementAs far as anyone can tell, Schweitzer was right: Bob the dinosaur really did have a store of medullary bone when she died. A paper published in Science last June presents microscope pictures of medullary bone from ostrich and emu side by side with dinosaur bone, showing near-identical features.

In the course of testing a B. rex bone fragment further, Schweitzer asked her lab technician, Jennifer Wittmeyer, to put it in weak acid, which slowly dissolves bone, including fossilized bone—but not soft tissues. One Friday night in January 2004, Wittmeyer was in the lab as usual. She took out a fossil chip that had been in the acid for three days and put it under the microscope to take a picture. “[The chip] was curved so much, I couldn’t get it in focus,” Wittmeyer recalls. She used forceps to flatten it. “My forceps kind of sunk into it, made a little indentation and it curled back up. I was like, stop it!” Finally, through her irritation, she realized what she had: a fragment of dinosaur soft tissue left behind when the mineral bone around it had dissolved. Suddenly Schweitzer and Wittmeyer were dealing with something no one else had ever seen. For a couple of weeks, Wittmeyer said, it was like Christmas every day.

In the lab, Wittmeyer now takes out a dish with six compartments, each holding a little brown dab of tissue in clear liquid, and puts it under the microscope lens. Inside each specimen is a fine network of almost-clear branching vessels—the tissue of a female Tyrannosaurus rex that strode through the forests 68 million years ago, preparing to lay eggs. Close up, the blood vessels from that T. rex and her ostrich cousins look remarkably alike. Inside the dinosaur vessels are things Schweitzer diplomatically calls “round microstructures” in the journal article, out of an abundance of scientific caution, but they are red and round, and she and other scientists suspect that they are red blood cells.

Of course, what everyone wants to know is whether DNA might be lurking in that tissue. Wittmeyer, from much experience with the press since the discovery, calls this “the awful question”—whether Schweitzer’s work is paving the road to a real-life version of science fiction’s Jurassic Park, where dinosaurs were regenerated from DNA preserved in amber. But DNA, which carries the genetic script for an animal, is a very fragile molecule. It’s also ridiculously hard to study because it is so easily contaminated with modern biological material, such as microbes or skin cells, while buried or after being dug up. Instead, Schweitzer has been testing her dinosaur tissue samples for proteins, which are a bit hardier and more readily distinguished from contaminants. Specifically, she’s been looking for collagen, elastin and hemoglobin. Collagen makes up much of the bone scaffolding, elastin is wrapped around blood vessels and hemoglobin carries oxygen inside red blood cells.

Because the chemical makeup of proteins changes through evolution, scientists can study protein sequences to learn more about how dinosaurs evolved. And because proteins do all the work in the body, studying them could someday help scientists understand dinosaur physiology—how their muscles and blood vessels worked, for example.

Proteins are much too tiny to pick out with a microscope. To look for them, Schweitzer uses antibodies, immune system molecules that recognize and bind to specific sections of proteins. Schweitzer and Wittmeyer have been using antibodies to chicken collagen, cow elastin and ostrich hemoglobin to search for similar molecules in the dinosaur tissue. At an October 2005 paleontology conference, Schweitzer presented preliminary evidence that she has detected real dinosaur proteins in her specimens.

Further discoveries in the past year have shown that the discovery of soft tissue in B. rex wasn’t just a fluke. Schweitzer and Wittmeyer have now found probable blood vessels, bone-building cells and connective tissue in another T. rex, in a theropod from Argentina and in a 300,000-year-old woolly mammoth fossil. Schweitzer’s work is “showing us we really don’t understand decay,” Holtz says. “There’s a lot of really basic stuff in nature that people just make assumptions about.”

young-earth creationists also see Schweitzer’s work as revolutionary, but in an entirely different way. They first seized upon Schweitzer’s work after she wrote an article for the popular science magazine Earth in 1997 about possible red blood cells in her dinosaur specimens. Creation magazine claimed that Schweitzer’s research was “powerful testimony against the whole idea of dinosaurs living millions of years ago. It speaks volumes for the Bible’s account of a recent creation.”

This drives Schweitzer crazy. Geologists have established that the Hell Creek Formation, where B. rex was found, is 68 million years old, and so are the bones buried in it. She’s horrified that some Christians accuse her of hiding the true meaning of her data. “They treat you really bad,” she says. “They twist your words and they manipulate your data.” For her, science and religion represent two different ways of looking at the world; invoking the hand of God to explain natural phenomena breaks the rules of science. After all, she says, what God asks is faith, not evidence. “If you have all this evidence and proof positive that God exists, you don’t need faith. I think he kind of designed it so that we’d never be able to prove his existence. And I think that’s really cool.”

By definition, there is a lot that scientists don’t know, because the whole point of science is to explore the unknown. By being clear that scientists haven’t explained everything, Schweitzer leaves room for other explanations. “I think that we’re always wise to leave certain doors open,” she says.

But schweitzer’s interest in the long-term preservation of molecules and cells does have an otherworldly dimension: she’s collaborating with NASA scientists on the search for evidence of possible past life on Mars, Saturn’s moon Titan, and other heavenly bodies. (Scientists announced this spring, for instance, that Saturn’s tiny moon Enceladus appears to have liquid water, a probable precondition for life.)

Astrobiology is one of the wackier branches of biology, dealing in life that might or might not exist and might or might not take any recognizable form. “For almost everybody who works on NASA stuff, they are just in hog heaven, working on astrobiology questions,” Schweitzer says. Her NASA research involves using antibodies to probe for signs of life in unexpected places. “For me, it’s the means to an end. I really want to know about my dinosaurs.”

AdvertisementTo that purpose, Schweitzer, with Wittmeyer, spends hours in front of microscopes in dark rooms. To a fourth-generation Montanan, even the relatively laid-back Raleigh area is a big city. She reminisces wistfully about scouting for field sites on horseback in Montana. “Paleontology by microscope is not that fun,” she says. “I’d much rather be out tromping around.”

“My eyeballs are just absolutely fried,” Schweitzer says after hours of gazing through the microscope’s eyepieces at glowing vessels and blobs. You could call it the price she pays for not being typical.


TOPICS: Heated Discussion
KEYWORDS: crevolist; dinosaur; dinosaurs; evolution; godsgravesglyphs; maryschweitzer; paleontology; shocker
Navigation: use the links below to view more comments.
first previous 1-20 ... 481-500, 501-520, 521-540 ... 1,701 next last
To: mlc9852
I think they use the reasoning that if God can creat anything, He can start with things as they were 5,000 or 6,000 years ago.

Maybe if there is a young earther on this thread, he can correct me.

501 posted on 05/02/2006 6:51:52 AM PDT by William Terrell (Individuals can exist without government but government can't exist without individuals.)
[ Post Reply | Private Reply | To 498 | View Replies]

To: Conservative Texan Mom
Thanks for the scripture reference. I often struggle to remember exact references.

Also, I found it interesting in college I had a discussion with a physics major. He stated that although physics formulas could explain nearly everything regarding time and space one dilemma still remained. The causation for energy flow from one form to another (i.e. the growth and decay of an apple).

In considering God's invisible qualities - He being all-seeing, all-knowing, and all-powerful. Power being energy, I contemplated some years later that if you take these qualities universally then you begin to see how nothing exists w/o Him. God is the one who is always actively at work maintaining the balance of the universe. Miracles are nothing for God but transmogrifying the sub-atomic structure of the atoms (i.e. making water gush forth from solid rock).

Comforting then to know that He is with all of us always just in the very act of sustaining our lives.

Interesting too that my chiropractor pointed out how all our lives every cell and organ of our bodies are constantly being regenerated. That within a years time every cell in your body has been replaced - some faster than others. God makes all thing new.
502 posted on 05/02/2006 6:57:50 AM PDT by BrandtMichaels
[ Post Reply | Private Reply | To 379 | View Replies]

To: mlc9852
One creationist response to such arguments regarding human/chimp DNA similarity has been that ‘Chimp DNA has not been anywhere near fully sequenced so that a proper comparison can be made’,5 and that this evidence is just as easily explained (and predicted, for that matter) by the concept of a common designer:

You might try finding a reference from a legitimate source, not Answers in Genesis, an on-line catalog of lies and half-truths. You might also choose an up-to-date reference. The two genomes are now published and on line.

503 posted on 05/02/2006 7:05:41 AM PDT by Right Wing Professor
[ Post Reply | Private Reply | To 464 | View Replies]

To: Right Wing Professor

You shouldn't be surprised. You are speaking to troll who hangs on to creationist arguments that Ken Ham has abandoned as too embarrassing such as the dino/human footprints.


504 posted on 05/02/2006 7:11:26 AM PDT by js1138 (somewhere, some time ago, something happened, but whatever it was, wasn't evolution)
[ Post Reply | Private Reply | To 503 | View Replies]

To: Elsie
My, what an eloquent reply.

Finding pictures was probably easier for you than pulling up the genomes, huh?

505 posted on 05/02/2006 7:11:58 AM PDT by Right Wing Professor
[ Post Reply | Private Reply | To 477 | View Replies]

To: Elsie
Hey Elsie, here's a different kind of text dump. Two stretches of genomes, both from Chromosome 10, one human, one chimp. Which is you and which is the ape?
CCAGCGTGCGTGTTCCTGTGCCTGTGGGAG
CTGGCTATCTCAGCGGGTGGGTGCCTCACC
TTGCCCTGTCCTCCCCCTCGACCTCACTCT
CCTTCCTTCTCATCCCCCTCCAGATTGACA
AGTATCTCTATGCCATGCGGCTCTCCGATG
AAACTCTCATAGATATCATGACTCGCTTCA
GGAAGGAGATGAAGAATGGCCTCTCCCGG
GATTTTAATCCAACAGCCACAGTCAAGATG
TTGCCAACATTCGTAAGGTCCATTCCTGAT
GGCTCTGGT

CCAGCGTGCGTGTTCCTGTGCCTGTGGGAG
CTGGCTATCTTGGCGGGTGGGTGCCTCACC
TTGCCCTGTCCTCCCCCTCGACCTCACTCT
CCTTCCTTCTCATCCCCCTCCAGATTGACA
AGTATCTCTATGCCATGCGGCTCTCCGATG
AAACTCTCATAGATATCATGACTCGCTTCA
GGAAGGAGATGAAGAATGGCCTCTCCCGG
GATTTTAATCCAACAGCCACAGTCAAGATG
TTGCCAACATTCGTAAGGTCCATTCCTGAT
GGCTCTGGT

Go ahead. It's really easy.

506 posted on 05/02/2006 7:17:32 AM PDT by Right Wing Professor
[ Post Reply | Private Reply | To 480 | View Replies]

To: Right Wing Professor

Answers in Genesis is a legitimate source. Just because you disagree with it doesn't make it not legitimate.


507 posted on 05/02/2006 7:21:39 AM PDT by mlc9852
[ Post Reply | Private Reply | To 503 | View Replies]

To: mlc9852
Answers in Genesis is a legitimate source.

In your dreams.

508 posted on 05/02/2006 7:27:46 AM PDT by Right Wing Professor
[ Post Reply | Private Reply | To 507 | View Replies]

To: BrandtMichaels

I say this in every one of these threads:

"Micro-evolution" IS evolution. Why is it so difficult to understand that when you spread out small, incremental steps over a very long period of time, large changes can occur?

By the way, how do you know that other animals don't have some form of abstract thinking, spiritual awareness, etc? Just because they don't manifest them in complex language doesn't mean they don't have some rudimentary "minds". Surely you don't believe that animals don't communicate with each other, and with us. Watch your pets interact with each other; they most certainly are communicating.


509 posted on 05/02/2006 7:34:23 AM PDT by 2nsdammit (By definition it's hard to get suicide bombers with experience.)
[ Post Reply | Private Reply | To 339 | View Replies]

To: mlc9852

See #63.


510 posted on 05/02/2006 7:35:04 AM PDT by ahayes (Yes, I have a devious plot. No, you may not know what it is.)
[ Post Reply | Private Reply | To 507 | View Replies]

To: Right Wing Professor

I doubt you know anything about my dreams, oh high Professor.


511 posted on 05/02/2006 7:41:24 AM PDT by mlc9852
[ Post Reply | Private Reply | To 508 | View Replies]

To: Right Wing Professor

Yes.


512 posted on 05/02/2006 7:44:24 AM PDT by Doctor Stochastic (Vegetabilisch = chaotisch ist der Charakter der Modernen. - Friedrich Schlegel)
[ Post Reply | Private Reply | To 506 | View Replies]

To: mlc9852
I doubt you know anything about my dreams, oh high Professor.

Vee program your dreams und beam zem into your head zrough ze tooth fillings. Be afraid. Be very afraid.

513 posted on 05/02/2006 7:46:52 AM PDT by Right Wing Professor
[ Post Reply | Private Reply | To 511 | View Replies]

To: mlc9852

Please explain to me where Darwin and the Theory of Evolution contradict a Creator.


514 posted on 05/02/2006 7:47:24 AM PDT by Kozak (Anti Shahada: " There is no God named Allah, and Muhammed is his False Prophet")
[ Post Reply | Private Reply | To 10 | View Replies]

To: William Terrell

Dear all FR readers actually,

I have not always been a YEC but my faith has 'evolved' (OK actually strengthened) as I have (and still continue) to read God's Word. My cousin is a pastor. At a family reunion we we're discussing an idea I had run across on the internet that since a day is as a thousand years and a thousand years as a day that possibly creation was a 6,000 year 'week'.

This was a very weak argument as soon as I unfolded it. He simply pointed out how we need to take the Bible literally when it is speaking literally. How with each creation day God defined it with 'there was evening and there was morning' while the 1000 day reference was symbolic of Christ's return.

He also pointed out that altering God's Word to say something it doesn't is tantamount to what we see liberal christian churches doing today (i.e. homosexuality). That possibly we can come to question and lose our very salvation when we begin to re-define God's Holy Word.

I saw this website refernced on FR a while back - the best and most complete explanation for YEC that I have seen yet: http://www.creationscience.com/ I've read the book twice now - once online and then again when I bought the book.

It shows why age-dating is so very confusing. As a computer programmer/analyst for over 20 years I know what havoc assumptions can do to application code (esp. unstated/unknown assumptions).

Furthermore, if the physical universe had not undergone some very very extreme changes, then evolution seems more palatable when viewed in the reference of uniformtarianism - the idea that certain conditions have always been the same since the beginning of time. Yet we know w/ global-warming this is not true. Heck, if it were just true w/ app code I would either a.) only need to write new code or b.) be out of a job.

Actually, I spend close to 80% of the time maintaining old code - usaually that which didn't follow the KISS principle b/c some bozo was so proud of how complicated (err sophisticated) he could write it. I should thank all the bozos for my job security but the jury is still out due to mgmt decisions to outsource and/or replace w/ H1B's.

Consider this too. 1st Earth was perfect - prior to original sin. 2nd Earth was better than today's b/c mankind lived close to 1,000 years - possibly due simply to plant/animal foods being much more highly nutritious. 3rd Earth is todays - and God said he would limit mans' time to 120 years. Recent scientific research concluded the same.

Some would say 4th Earth was AD till now but I think it is actaully the new Heaven/Earth from Revelations that follows Armageddon.

BTW last night I prayed for all you fine folks on here - yes the evolutionists too - not just bc I once were one.

I was analyzing over God's Word about praying constantly and wondering why an all-powerful God requires this. I realized first that prayer brings me closer to God. But I also think I had a revelation - consider that this world is utterly polluted by sin. That sin constanly dirties the windows of our atmosphere. Then think of prayer as a window cleaner that could basically clear it away and allow God's Light to shine on your life and all those lives that you pray over. Obviously no matter how much Biblical truth is revealed to you - you won't understand it here in your fallen sinful physical nature but you can always get closer than before and help others in the process.

I have always enjoyed learning and will continue to do so - till? - well after my physical demise I think. Here another website you may find insightful: www.oneplace.com/ministries/Grace_to_You/ - per my John MacArthur references. Sorry so long and Godspeed to all.


515 posted on 05/02/2006 7:51:24 AM PDT by BrandtMichaels
[ Post Reply | Private Reply | To 501 | View Replies]

To: js1138

"Believe it or not, neither does AIG, but that doesn't stop people from posting it on FR."

I think that's the most frustrating part of these threads - we continue to show how the ID "evidence" is wrong, has been disproven, or even is an outright hoax, and the same stuff keeps cropping up, whack-a-mole-like.....


516 posted on 05/02/2006 7:56:30 AM PDT by 2nsdammit (By definition it's hard to get suicide bombers with experience.)
[ Post Reply | Private Reply | To 381 | View Replies]

To: BrandtMichaels
It shows why age-dating is so very confusing.

We set problems on age dating in Freshman Chemistry class. Most of them (and they're mostly not chemistry majors) don't seem to be confused.

As a computer programmer/analyst for over 20 years I know what havoc assumptions can do to application code (esp. unstated/unknown assumptions).

Identify one unstated/unknown assumption in radioisotope dating.

517 posted on 05/02/2006 7:56:35 AM PDT by Right Wing Professor
[ Post Reply | Private Reply | To 515 | View Replies]

To: Doctor Stochastic
Yes.

Is that your final answer? :-)

518 posted on 05/02/2006 7:57:38 AM PDT by Right Wing Professor
[ Post Reply | Private Reply | To 512 | View Replies]

To: BrandtMichaels

Sorry for the spelling and grammatical errors. Thought I didn't have more time here at the public library.

Meant to say:
Obviously no matter how much Biblical truth is revealed to you - you won't understand it ALL here in your fallen sinful physical nature but you can always get closer than before and help others in the process.


519 posted on 05/02/2006 7:58:29 AM PDT by BrandtMichaels
[ Post Reply | Private Reply | To 515 | View Replies]

To: Right Wing Professor

There are plenty of them on the creationscience site I listed which I much prefer over AIG (read that one too).

Maybe we'd all be better off if we listed our own assumptions. I think nothing would keep each person busier than spending time trying to eliminate their own assumptions and/or hypocrisy - I know bc I am a work in progress on both of these still so please forgive my errors as I do yours.


520 posted on 05/02/2006 8:03:07 AM PDT by BrandtMichaels
[ Post Reply | Private Reply | To 517 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 481-500, 501-520, 521-540 ... 1,701 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Smoky Backroom
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson