Free Republic
Browse · Search
News/Activism
Topics · Post Article

Skip to comments.

Ancient DNA traces origin of Black Death
Nature ^

Posted on 06/16/2022 5:12:23 AM PDT by FarCenter

A Silk Road stopover might have been the epicentre of one of humanity’s most destructive pandemics.

People who died in a fourteenth-century outbreak in what is now Kyrgyzstan were killed by strains of the plague-causing bacterium Yersinia pestis that gave rise to the pathogens responsible several years later for the Black Death, shows a study of ancient genomes.

“It is like finding the place where all the strains come together, like with coronavirus where we have Alpha, Delta, Omicron all coming from this strain in Wuhan,” says Johannes Krause, a palaeogeneticist at the Max Planck Institute for Evolutionary Anthropology in Leipzig, Germany, who co-led the study, published on 15 June in Nature1.

Between 1346 and 1353, the Black Death laid waste to western Eurasia, killing up to 60% of the populace in some places. Historical records suggest that the bubonic plague emerged from the east: Caffa, on the Crimean peninsula, experienced one of the earliest-recorded outbreaks of plague during a 1346 siege by the army of the Mongol Empire. The Caucasus and other locales in Central Asia have been put forward as potential epicentres.

China hosts some of the world’s greatest genetic diversity of modern Y. pestis strains, hinting at an East Asian origin for the Black Death. “There were all kinds of hypotheses in the literature. And it was not really known where it exactly came from,” says Krause.

(Excerpt) Read more at nature.com ...


TOPICS: Culture/Society; News/Current Events
KEYWORDS: ancientautopsies; blackdeath; disease; europe; ggg; godsgravesglyphs; helixmakemineadouble; kyrgyzstan; middleages; plague; silkroad; yersiniapestis

1 posted on 06/16/2022 5:12:23 AM PDT by FarCenter
[ Post Reply | Private Reply | View Replies]

To: FarCenter

Historians had pretty well pinned this down long ago.. Guess it’s nice to have the dna evidence too.


2 posted on 06/16/2022 5:14:58 AM PDT by hinckley buzzard ( Resist the narrative.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: FarCenter

I thought the Black Death was centered in Democrat controlled cities.


3 posted on 06/16/2022 5:18:56 AM PDT by HighSierra5 (The only way you know a commie is lying is when they open their pieholes.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: FarCenter

Oh geez...don’t give Fauci and Daszak any ideas.


4 posted on 06/16/2022 5:20:39 AM PDT by moovova
[ Post Reply | Private Reply | To 1 | View Replies]

To: FarCenter

They can trace a 14th century pathogen back to its origins but can’t (wont) tell us where the Wuhan virus started.
Riiiight.


5 posted on 06/16/2022 5:20:43 AM PDT by ArtDodger
[ Post Reply | Private Reply | To 1 | View Replies]

To: hinckley buzzard

I hope they aren’t getting any ideas.


6 posted on 06/16/2022 5:20:57 AM PDT by dforest (We have to put a stop to this now.)
[ Post Reply | Private Reply | To 2 | View Replies]

To: FarCenter

Fauci?


7 posted on 06/16/2022 5:21:12 AM PDT by freespirit2012
[ Post Reply | Private Reply | To 1 | View Replies]

To: FarCenter

BLACK DEATH...

Is WHO and the CDC preparing to reintroduce this killer into the atmosphere next?


8 posted on 06/16/2022 5:23:36 AM PDT by stars & stripes forever (Blessed the nation whose GOD is the LORD. ~ Psalm 33:12)
[ Post Reply | Private Reply | To 1 | View Replies]

To: ArtDodger

Probably some German guy named Pfizer


9 posted on 06/16/2022 5:25:15 AM PDT by woodbutcher1963
[ Post Reply | Private Reply | To 5 | View Replies]

To: FarCenter

Related:
https://freerepublic.com/focus/f-chat/4071304/posts


10 posted on 06/16/2022 5:29:35 AM PDT by Red Badger (Homeless veterans camp in the streets while illegal aliens are put up in hotels.....................)
[ Post Reply | Private Reply | To 1 | View Replies]

Comment #11 Removed by Moderator

To: stars & stripes forever

“BLACK DEATH…”

WHO has to come up with a new, inoffensive name for it first.


12 posted on 06/16/2022 5:54:54 AM PDT by mikey_hates_everything
[ Post Reply | Private Reply | To 8 | View Replies]

To: FarCenter
“It is like finding the place where all the strains come together, like with coronavirus where we have Alpha, Delta, Omicron all coming from this strain in Wuhan

Come together…over Fauci
13 posted on 06/16/2022 6:04:01 AM PDT by Jan_Sobieski (Sanctification)
[ Post Reply | Private Reply | To 1 | View Replies]

To: FarCenter

I hope these scientists are ready to be called racists all over television.


14 posted on 06/16/2022 6:24:26 AM PDT by The Old Hoosier (Right makes might)
[ Post Reply | Private Reply | To 1 | View Replies]

To: FarCenter

Comparing COVID to the Black Plague is a joke. But I knew they couldn’t help themselves.


15 posted on 06/16/2022 6:28:11 AM PDT by the OlLine Rebel (Common sense is an uncommon virtue./Federal-run medical care is as good as state-run DMVds)
[ Post Reply | Private Reply | To 1 | View Replies]

To: ArtDodger

Things that make you go 🤔


16 posted on 06/16/2022 6:44:40 AM PDT by Eagles6 (Welcome to the Matrix . Orwell's "1984" was a warning, not an instruction manual.)
[ Post Reply | Private Reply | To 5 | View Replies]

To: FarCenter

What happens in china should stay in china.


17 posted on 06/16/2022 6:52:30 AM PDT by Track9 (You are far too inquisitive not to be seduced…)
[ Post Reply | Private Reply | To 1 | View Replies]

To: FarCenter

18 posted on 06/26/2022 3:43:29 PM PDT by SunkenCiv (Imagine an imaginary menagerie manager imagining managing an imaginary menagerie.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: SunkenCiv

https://twitter.com/NoContextBrits/status/1693615642593640904

19 posted on 08/22/2023 7:47:18 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 18 | View Replies]

To: AdmSmith

20 posted on 08/22/2023 9:35:29 AM PDT by SunkenCiv (Putin should skip ahead to where he kills himself in the bunker.)
[ Post Reply | Private Reply | To 19 | View Replies]

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
News/Activism
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson