Free Republic
Browse · Search
News/Activism
Topics · Post Article


1 posted on 11/12/2019 10:18:52 AM PST by Red Badger
[ Post Reply | Private Reply | View Replies ]


Navigation: use the links below to view more comments.
first 1-2021-24 next last
To: Red Badger

Per Capita it is down, but overall it is up... this is more to do with Wal Mart and other chains cutting ties with Dean and getting their own direct suppliers.


2 posted on 11/12/2019 10:19:49 AM PST by HamiltonJay
[ Post Reply | Private Reply | To 1 | View Replies ]

To: Red Badger

Part of the problem for them is the fact that the idea of Milk being good for you, has faded.


3 posted on 11/12/2019 10:20:04 AM PST by Paradox (Don't call them mainstream, there is nothing mainstream about the MSM.)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: Red Badger

Wowsa. I drink almond milk but not a big milk drinker period.


4 posted on 11/12/2019 10:20:49 AM PST by BipolarBob (Bipolars have more fun. No we don't.)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: Red Badger

The vegans will milk this to show they are winning.


7 posted on 11/12/2019 10:22:26 AM PST by Meatspace
[ Post Reply | Private Reply | To 1 | View Replies ]

To: Red Badger

I almost never see their product except in convenience stores.

Just about every grocery store people I’m in has their own private label brand. I can tell you the kids in my family drink as much of it as I did growing up.


9 posted on 11/12/2019 10:22:47 AM PST by PittsburghAfterDark (There is no one more racist than a white liberal.)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: Red Badger

“...Despite our best efforts to make our business more agile and cost-efficient, we continue to be impacted by a challenging operating environment marked by continuing declines in consumer milk consumption,” CEO Eric Berigause...”

I think I see the problem. That’s MBA speak for we don’t know what the hell we are doing. (”Agile” being the tip-off word.)


15 posted on 11/12/2019 10:24:43 AM PST by Bonemaker (invictus maneo)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: Red Badger

Nothing is guaranteed to last forever, not even billion dollar industries. For various reasons, certain products will lose favor from one generation to the next. Some will refuse to patronize the same products they grew up with just because those old products were forced on them by their parents.


21 posted on 11/12/2019 10:26:56 AM PST by lee martell
[ Post Reply | Private Reply | To 1 | View Replies ]

To: Red Badger

We have too much milk. Cow farmers now run their business at a far lower cost. Now a farmer can run a good sized operation with just a handful of employees. Cows never leave the barn. Its just too easy for larger dairies to become larger. Its gotten to the point that Wisconsin can make all the milk America needs. California and Florida are shrinking milk production because the land is more valuable for other purposes. The free market is simply at work here taking out middle men on a very efficient business.


24 posted on 11/12/2019 10:28:10 AM PST by poinq
[ Post Reply | Private Reply | To 1 | View Replies ]

To: Red Badger
This https://en.wikipedia.org/wiki/Dean_Foods indicates bad management and why not integrate downstream for yogurt and cheese?
26 posted on 11/12/2019 10:31:06 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: Red Badger

Does this mean the Milkmen are Dead?


30 posted on 11/12/2019 10:34:08 AM PST by Meatspace
[ Post Reply | Private Reply | To 1 | View Replies ]

To: Red Badger

Milk is rayciss.


34 posted on 11/12/2019 10:41:12 AM PST by DrPretorius
[ Post Reply | Private Reply | To 1 | View Replies ]

To: Red Badger

“almond and soy milk”

the labels i’ve read on almond and soy “milk” in the grocery stores indicate that they’re just another highly sugared juice ...


35 posted on 11/12/2019 10:41:16 AM PST by catnipman (Cat Nipman: Vote Republican in 2012 and only be called racist one more time!)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: Red Badger

15 years or so ago I traveled NC Hwy 62 in a section that was nothing but former dairies. It was the bread and butter of farming in that section of the state for over 100 years.

It was ghost town that was miles long with one abandoned dairy after another. A sad sight of old barns, silos, feed pens that provided jobs, built families and put a lot of kids through college back in the day.


48 posted on 11/12/2019 10:50:34 AM PST by Rebelbase
[ Post Reply | Private Reply | To 1 | View Replies ]

To: Red Badger
but mostly the rise of so many other choices, including teas, sodas, juices and almond and soy milk.

Dean, you make one of those items except the soda. You also produced bottled water.

Pull the other one, it has bells on it.

52 posted on 11/12/2019 10:52:43 AM PST by Harmless Teddy Bear (A hero is a hero no matter what medal they give him. Likewise a schmuck is still a schmuck.)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: Red Badger

“Since 1975, the amount of milk consumed per capita in America has tumbled more than 40%”

Sorry, my fault. That was the year I was diagnosed with lactose intolerance.


54 posted on 11/12/2019 10:53:23 AM PST by READINABLUESTATE
[ Post Reply | Private Reply | To 1 | View Replies ]

To: Red Badger

We pay almost 4.00 for a half gallon of whole milk - gladly. It is the A2 brand, natural milk with no additives, it is just devoid of the A1 protein that is a mutation that many dairy cows carry. We used to drink only our own goats milk for 25 years. Goats milk, sheeps milk other mammal milk is all A2 protein. Many people who think they are lactose intolerant are actually reacting to the A1 protein. These are all facts. There are research studies out there. On a lighter milk related note, this youtube on almond milk is hilarioushttps://www.youtube.com/watch?v=JJCTIPWPNtw


55 posted on 11/12/2019 10:53:30 AM PST by MomwithHope (Forever grateful to all our patriots, past, present and future.)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: Red Badger

My family has been doing our part! Milk keeps getting more and more expensive. I’m seriously considering adding a few dairy sheep to my farm.


67 posted on 11/12/2019 11:00:57 AM PST by Ellendra (A single lie on our side does more damage than a thousand lies on their side.)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: Red Badger

I wonder if Dean Foods were unionized? A quick internet search shows their drivers appear to be. I remember years ago when Hostess went under it was because of the inflexibility of their union drivers. A real case of the “tail wagging the dog.”


69 posted on 11/12/2019 11:03:53 AM PST by BradyLS (DO NOT FEED THE BEARS!)
[ Post Reply | Private Reply | To 1 | View Replies ]

To: Red Badger

Perhaps a tangential cause that isn’t given much thought, 1970 being when the effects of Hart-Cellar began to be noticed, is the larger percentage of population stock that is genetically predisposed to lactose intolerance.


76 posted on 11/12/2019 11:12:13 AM PST by Mr. Blond
[ Post Reply | Private Reply | To 1 | View Replies ]

To: Red Badger

North Central Florida milk is about $2.37/gal. at Walmart and $4/gal. at Publix. There’s a BP gas station near here that sells beer at a price comparable to the grocery stores, but T.G. Lee milk is $6/gal....


78 posted on 11/12/2019 11:16:31 AM PST by jeffc (The U.S. media are our enemy)
[ Post Reply | Private Reply | To 1 | View Replies ]


Navigation: use the links below to view more comments.
first 1-2021-24 next last

Free Republic
Browse · Search
News/Activism
Topics · Post Article


FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson