Free Republic
Browse · Search
General/Chat
Topics · Post Article

Skip to comments.

This 5,000-Year-Old Tomb Is Spectacularly Preserved [Maeshowe, Orkney] [2:54]
YouTube ^ | October 15, 2024 | Smithsonian Magazine

Posted on 10/18/2024 9:46:08 PM PDT by SunkenCiv

Despite the fact that it’s over 5,000 years old, Maeshowe, Orkney's answer to Stonehenge, is in amazing shape. But why did Neolithic Britons go to such great lengths to build it?
This 5,000-Year-Old Tomb Is Spectacularly Preserved | 2:54
Smithsonian Magazine | 35.3K subscribers | 29,963 views | October 15, 2024
This 5,000-Year-Old Tomb Is Spectacularly Preserved | 2:54 | Smithsonian Magazine | 35.3K subscribers | 29,963 views | October 15, 2024

https://www.youtube.com/watch?v=D026QAAuIwU

(Excerpt) Read more at youtube.com ...


TOPICS: History; Science; Travel
KEYWORDS: ancientnavigation; archaeoastronomy; europe; godsgravesglyphs; maeshowe; megaliths; orkney; tomb

1 posted on 10/18/2024 9:46:08 PM PDT by SunkenCiv
[ Post Reply | Private Reply | View Replies]

The rest of the Orkney keyword, sorted:

2 posted on 10/18/2024 9:50:08 PM PDT by SunkenCiv (Putin should skip ahead to where he kills himself in the bunker.)
[ Post Reply | Private Reply | View Replies]

To: StayAt HomeMother; Ernest_at_the_Beach; 1ofmanyfree; 21twelve; 24Karet; 2ndDivisionVet; 31R1O; ...

3 posted on 10/18/2024 9:50:33 PM PDT by SunkenCiv (Putin should skip ahead to where he kills himself in the bunker.)
[ Post Reply | Private Reply | View Replies]

To: SunkenCiv

I hate cold. I can’t imagine why any sentient being would elect to live in Siberia. Or Point Barrow. I’ve been as far north as John O’ Groats, but the Orkneys were always just a few degrees (Fahrenheit & latitude) too far for comfort. To paraphrase Mark Twain, he coldest winter I’ve ever spent was a summer on the Isle of Skye.

But what amazes me about the Orneys is that Neolithic culture, the hinges and the like, spread south from there, not the other way around.

I hardly can imagine a more hostile environment this side of the moon, yet they obviuusly had a sophisticated civilization.

Buurrrrrr!


4 posted on 10/18/2024 10:38:04 PM PDT by Paal Gulli
[ Post Reply | Private Reply | To 2 | View Replies]

To: Paal Gulli

Yeah, it’s gotta be difficult. Probably shows that it was preferable to whatever even worse spot they’d come from. By boat?


5 posted on 10/18/2024 11:44:13 PM PDT by SunkenCiv (Putin should skip ahead to where he kills himself in the bunker.)
[ Post Reply | Private Reply | To 4 | View Replies]

To: SunkenCiv

But why did Neolithic Britons go to such great lengths to build it?

After a long day hunting and gathering, they blew off steam hauling dirt and rocks around.

Seems pretty obvious since pubs and darts hadn’t been invented yet.


6 posted on 10/19/2024 2:25:11 AM PDT by Adder (End fascism...defeat all Democrats.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Paal Gulli

The Orkney people were unique in one other way. In the rest os Britain the population was replaced with male DNA from the continent and mated with original female DNA from the native Britons. In Orkney it was the other way around.


7 posted on 10/19/2024 5:59:41 AM PDT by JeanLM
[ Post Reply | Private Reply | To 4 | View Replies]

To: JeanLM; SunkenCiv

Map showing the proportions of Scandinavian and British/Irish ancestry for mtDNA (Mt) and Y-chromosomes (Y) for each of the admixed populations from the North Atlantic region included in this study. The Scottish island groups of Shetland, Orkney, the Western Isles and Skye, and the region that we define as the ‘North and West coast of Scotland’, are encircled for clarity.


Major events in the population history of the British Isles. Source: https://www.nature.com/articles/nature14230

https://stetson.substack.com/p/the-genetic-history-of-the-british

https://www.researchgate.net/figure/Map-showing-the-proportions-of-Scandinavian-and-British-Irish-ancestry-for-mtDNA-Mt-and_fig1_7920315

The search continues.

8 posted on 10/19/2024 9:59:50 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 7 | View Replies]

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
General/Chat
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson