Free Republic
Browse · Search
General/Chat
Topics · Post Article

Skip to comments.

Ebola Surveillance Thread
Free Republic Threads ^ | August 10, 2014 | Legion

Posted on 08/10/2014 12:46:23 AM PDT by Smokin' Joe

I have spent a little time compiling links to threads about the Ebola outbreak in the interest of having all the links in one thread for future reference.

Please add links to new threads and articles of interest as the situation develops.

Thank You all for you participation.


TOPICS: Health/Medicine
KEYWORDS: africa; airborne; cdc; czar; doctor; ebola; ebolaczar; ebolagate; ebolainamerica; ebolaoutbreak; ebolaphonywar; ebolastrains; ebolathread; ebolatransmission; ebolavaccine; ebolaviralload; ebolavirus; emory; epidemic; fluseason; frieden; health; healthcare; hospital; incubation; isolation; jahrling; liberia; nih; obamasfault; obola; outbreak; overpopulation; pandemic; peterjahrling; population; populationcontrol; protocols; publichealth; publicschools; quarantine; quarantined; ronklain; schools; sierraleone; talkradio; terrorism; thomasfrieden; tolerance; travel; travelban; trojanhorse; usarmy
Navigation: use the links below to view more comments.
first previous 1-20 ... 641-660661-680681-700 ... 5,021-5,032 next last
To: Black Agnes
That’s the chart to watch.

Thanks for the link. More accurate than the WHO numbers, but I believe still too low.
661 posted on 08/19/2014 12:24:00 PM PDT by PA Engineer (Liberate America from the Occupation Media.)
[ Post Reply | Private Reply | To 646 | View Replies]

To: Black Agnes

http://dailycaller.com/2014/08/19/africas-problem-with-ebola-and-medical-science/


662 posted on 08/19/2014 12:25:10 PM PDT by Black Agnes
[ Post Reply | Private Reply | To 660 | View Replies]

To: PA Engineer

Who knows how many depopulated villages there are in the hinterlands at this point.


663 posted on 08/19/2014 12:25:29 PM PDT by Black Agnes
[ Post Reply | Private Reply | To 661 | View Replies]

To: Black Agnes

http://www.thetrentonline.com/3-fresh-ebola-cases-discovered-kaduna-lagos/?utm_source=rss&utm_medium=rss&utm_campaign=3-fresh-ebola-cases-discovered-kaduna-lagos&utm_source=twitterfeed&utm_medium=twitter


664 posted on 08/19/2014 12:27:41 PM PDT by Black Agnes
[ Post Reply | Private Reply | To 663 | View Replies]

To: Black Agnes
Also on Monday, Mercy Ships, which operates the Africa Mercy hospital ship, announced that the Africa Mercy was due to sail for the port of Cotonou, Benin, for its 10-month field service last week, but has delayed its departure pending further assessment due to the virulence of the outbreak in neighboring Nigeria.

Nigeria is not being banned from the Haj. That would provide a very rapid vector to the rest of the world.
665 posted on 08/19/2014 12:30:44 PM PDT by PA Engineer (Liberate America from the Occupation Media.)
[ Post Reply | Private Reply | To 649 | View Replies]

To: PA Engineer

Not being banned from the Hajj YET IMHO.


666 posted on 08/19/2014 12:50:29 PM PDT by Black Agnes
[ Post Reply | Private Reply | To 665 | View Replies]

To: Smokin' Joe
AFL Ordered To Shoot Anyone Crossing Borders At Night (Liberia)
667 posted on 08/19/2014 1:06:09 PM PDT by Smokin' Joe (How often God must weep at humans' folly. Stand fast. God knows what He is doing.)
[ Post Reply | Private Reply | To 613 | View Replies]

To: Lady Heron

1. the Ebola epidemic will be self contained in the region, but many more will be infected. R0 = about 3. It is, as you write, very dangerous in these poor countries, lacking even rubber gloves, but not in the industrialized world.

2. The big danger is a pandemic influenza.

3. The idea about 3000 Ebola suicide warriors is just the bad imagination from this crazy site http://www.thetotalcollapse.com/3000-ebola-martyrs-warned-ready-to-strike-america/ You can see other Bravo Sierra texts at their site.


668 posted on 08/19/2014 1:17:26 PM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 644 | View Replies]

To: Black Agnes

http://www.ndtv.com/article/world/two-suspected-cases-of-ebola-in-austria-regional-governor-578558


669 posted on 08/19/2014 1:19:42 PM PDT by Black Agnes
[ Post Reply | Private Reply | To 666 | View Replies]

To: Black Agnes

http://www.today.ng/news/ebola-dr-ameyo-adadevoh-dies-from-virus/

Nigerian lady doctor loses her battle with Ebola.


670 posted on 08/19/2014 1:22:19 PM PDT by Black Agnes
[ Post Reply | Private Reply | To 669 | View Replies]

To: Smokin' Joe
Ebola virus disease, West Africa – update 19 August 2014
671 posted on 08/19/2014 1:28:01 PM PDT by Smokin' Joe (How often God must weep at humans' folly. Stand fast. God knows what He is doing.)
[ Post Reply | Private Reply | To 667 | View Replies]

To: Smokin' Joe
Woman being tested for Ebola in Berlin
672 posted on 08/19/2014 1:31:50 PM PDT by Smokin' Joe (How often God must weep at humans' folly. Stand fast. God knows what He is doing.)
[ Post Reply | Private Reply | To 671 | View Replies]

To: Black Agnes

http://ncronline.org/news/global/ebola-cant-drive-philippines-missionaries-sierra-leone


673 posted on 08/19/2014 2:16:54 PM PDT by Black Agnes
[ Post Reply | Private Reply | To 670 | View Replies]

To: Black Agnes

http://www.nytimes.com/2014/08/20/world/africa/ebola-is-disaster-of-scale-still-unknown-relief-official-says.html


674 posted on 08/19/2014 2:45:55 PM PDT by Black Agnes
[ Post Reply | Private Reply | To 673 | View Replies]

To: Black Agnes

http://in.reuters.com/article/2014/08/19/us-health-ebola-liberia-idINKBN0GJ25U20140819?feedType=RSS&feedName=health&utm_source=dlvr.it&utm_medium=twitter&dlvrit=309303


675 posted on 08/19/2014 2:56:22 PM PDT by Black Agnes
[ Post Reply | Private Reply | To 674 | View Replies]

To: Black Agnes; Covenantor

http://boisestatepublicradio.org/post/ebola-skies-how-virus-made-it-west-africa?utm_source=dlvr.it&utm_medium=twitter


676 posted on 08/19/2014 3:15:44 PM PDT by Black Agnes
[ Post Reply | Private Reply | To 675 | View Replies]

To: Smokin' Joe
Two suspected cases of Ebola in Austria: regional governor
677 posted on 08/19/2014 5:57:48 PM PDT by Smokin' Joe (How often God must weep at humans' folly. Stand fast. God knows what He is doing.)
[ Post Reply | Private Reply | To 667 | View Replies]

To: Smokin' Joe
Ebola tests on British-Nigerian woman found dead in her apartment (Austria)
678 posted on 08/19/2014 6:03:50 PM PDT by Smokin' Joe (How often God must weep at humans' folly. Stand fast. God knows what He is doing.)
[ Post Reply | Private Reply | To 677 | View Replies]

To: Black Agnes

http://mashable.com/2014/08/19/air-france-petition-ebola/?utm_campaign=Mash-Prod-RSS-Feedburner-All-Partial&utm_cid=Mash-Prod-RSS-Feedburner-All-Partial&utm_medium=feed&utm_source=rss&utm_source=twitterfeed&utm_medium=twitter


679 posted on 08/19/2014 7:21:54 PM PDT by Black Agnes
[ Post Reply | Private Reply | To 676 | View Replies]

To: Black Agnes

http://sacramento.cbslocal.com/2014/08/19/sacramento-kaiser-permanente-patient-being-tested-for-ebola-after-possible-exposure/


680 posted on 08/19/2014 7:43:45 PM PDT by Black Agnes
[ Post Reply | Private Reply | To 676 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-20 ... 641-660661-680681-700 ... 5,021-5,032 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
General/Chat
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson