Free Republic
Browse · Search
General/Chat
Topics · Post Article

Skip to comments.

83,000 Bags of Frozen Shrimp Recalled Over Possible Radioactive Contamination: FDA
The Epoch Times ^ | December 23, 2025 | Jack Phillips

Posted on 12/23/2025 8:43:55 AM PST by Red Badger

The latest recall impacts Washington state-based Direct Source Seafood LLC products sold at various locations.

The U.S. Food and Drug Administration (FDA) confirmed a recall of more than 83,000 bags of raw frozen shrimp for potential radioactive contamination, expanding actions taken against shrimp products that were imported from Indonesia.

According to an announcement last week, Washington state-based Direct Source Seafood LLC is recalling 83,800 bags of frozen raw shrimp sold under the Market 32 and Waterfront Bistro brand names “because they may have been prepared, packed, or held under insanitary conditions whereby they may have become contaminated with” radioactive cesium-137, or Cs-137. “Traces of Cs-137 are widespread and can be present in the environment at background levels, and at higher levels in water or foods grown, raised, or produced in areas with environmental contamination,” said the company through the FDA’s website.

“The primary health effect of concern following longer term, repeated low dose exposure (e.g., through consumption of contaminated food or water over time) is an elevated risk of cancer, resulting from damage to DNA within living cells of the body.”

Stores that carried the shrimp include Price Chopper, Albertsons, Safeway, Jewel-Osco, and Lucky Supermarket, it said.

The shrimp was sold in locations in Colorado, Connecticut, Iowa, Idaho, Illinois, Indiana, Massachusetts, Montana, North Dakota, Nevada, New Hampshire, New York, Oregon, Pennsylvania, Utah, Wyoming, and Vermont, according to the recall statement.

The shrimp products sold by Price Chopper were packaged in 1-pound bags with UPC codes 0 41735 and 01358 3. Other stores had 2-pound bags that had codes 021130 and 13224-9.

“Consumers who have purchased affected shrimp should not consume the product and should dispose of or return it to the place of purchase for a full refund,” the recall statement said.

No illnesses have been reported in connection with the latest recall. No product that tested positive for Cs-137 has entered the U.S. marketplace, the FDA said.

The latest action marks an expansion of a recall of frozen shrimp products sourced by one Indonesian company due to the presence of Cs-137, a manmade isotope. The FDA said it is investigating reports of contamination in containers and frozen shipments produced by the company, PT. Bahari Makmur Sejati, which is doing business as BMS Foods.

In August, Walmart recalled frozen raw shrimp sold in 13 states due to potential radioactive contamination. At the time, the FDA asked Walmart to pull three lots of Great Value brand frozen shrimp from stores.

In separate recalls announced earlier this year, Southwind Foods LLC, AquaStar Corp., Beaver Street Fisheries LLC, and H&N Group Inc. recalled numerous lots and bags of shrimp sold in grocery stores due to potential contamination, the FDA said.

The FDA issued a safety alert in August warning consumers not to eat certain frozen shrimp imported from PT. Bahari Makmur Sejati. The radioactive isotope was detected in shipping containers from the company sent to several U.S. ports, as well as in a sample of frozen breaded shrimp. The FDA also posted an import alert to stop potentially contaminated shrimp from entering the United States. More than 3 million pounds of shrimp exported by BMS Foods have arrived at U.S. ports in September, according to U.S. Customs and Border Protection records. The level of cesium 137 detected in the frozen shrimp was about 68 becquerels per kilogram, a measure of radioactivity. That is far below the FDA’s level of 1,200 becquerels per kilogram that could trigger the need for health protections.


TOPICS: Agriculture; Business/Economy; Food; Health/Medicine
KEYWORDS: radioactiveshrimp; shrimp
Navigation: use the links below to view more comments.
first previous 1-2021-4041-51 next last
To: Red Badger

Why does so much of our seafood come from South East Asia? We have giant oceans on either side of our country and a giant gulf . Are there no fish, crab, clams, shrimp, lobsters, etc. in those waters?


21 posted on 12/23/2025 9:43:25 AM PST by Texas Eagle ("Throw me to the wolves and I'll return leading the pack"- Donald J. Trump)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Red Badger

With a half life of over 30 years a small particle absorbed into your body could cause serious health issues.


22 posted on 12/23/2025 9:44:15 AM PST by fella ("As it was before Noah so shall it be again," )
[ Post Reply | Private Reply | To 1 | View Replies]

To: Red Badger

For all the boiling water reactor fans here. Eat it- Its good for you.


23 posted on 12/23/2025 9:46:07 AM PST by Revel
[ Post Reply | Private Reply | To 1 | View Replies]

To: Red Badger

WHEW! I was worried it might have been the brand of the 4 lbs of frozen shrimp I recently picked up. I’m using them to make a BIG Hawaiian shrimp kebab on meal on the BBQ grill this weekend. For the first time I will be preparing Papaya seed dressing and will be marinating the shrimp in that. Fortunately NOT radioactive.


24 posted on 12/23/2025 9:51:11 AM PST by PJ-Comix (Yes, I am the Toxic Troll Terminator.")
[ Post Reply | Private Reply | To 1 | View Replies]

To: fella

Depends on your age.

All the animals inside the Chernobyl Exclusion Zone test way high for radiation above the recognized safe limit, yet they live normally and thrive, from tiny mice and voles to wolves, deer, bear and moose.

Why? The scientists were stunned.

Then they figured it out.

The animals don’t live long enough for it to be a problem.............


25 posted on 12/23/2025 9:51:34 AM PST by Red Badger (Iryna Zarutska, May 22, 2002 Kyiv, Ukraine – August 22, 2025 Charlotte, North Carolina Say her name)
[ Post Reply | Private Reply | To 22 | View Replies]

To: READINABLUESTATE; Red Badger; SunkenCiv; Rennes Templar; The Spirit Of Allegiance
they may have become contaminated with” radioactive cesium-137

Fukushrimpa

Some days though, all of my puns are in vein.

26 posted on 12/23/2025 9:55:35 AM PST by Ezekiel (🆘️ "Come fly with US". 🔴 Ingenuity -- because the Son of David begins with MARS ♂️, aka every man)
[ Post Reply | Private Reply | To 4 | View Replies]

To: Revel

They are!..................


27 posted on 12/23/2025 9:58:56 AM PST by Red Badger (Iryna Zarutska, May 22, 2002 Kyiv, Ukraine – August 22, 2025 Charlotte, North Carolina Say her name)
[ Post Reply | Private Reply | To 23 | View Replies]

To: Ezekiel

When there 83,000 bags of shrimp are contaminated, cesium immediately.


28 posted on 12/23/2025 10:03:17 AM PST by SunkenCiv (NeverTrumpin' -- it's not just for DNC shills anymore -- oh, wait, yeah it is.)
[ Post Reply | Private Reply | To 26 | View Replies]

To: SunkenCiv

‘Tis the Season!

to be freezin’

83,000 Bags of Frozen Shrimp Recalled
83,000 Bags
You take one out and pass it around
83,000 bags of frozen shrimp recalled

(Endless shrimp tell no tails)


29 posted on 12/23/2025 10:14:19 AM PST by Ezekiel (🆘️ "Come fly with US". 🔴 Ingenuity -- because the Son of David begins with MARS ♂️, aka every man)
[ Post Reply | Private Reply | To 28 | View Replies]

To: Red Badger
The level of cesium 137 detected in the frozen shrimp was about 68 becquerels per kilogram, a measure of radioactivity. That is far below the FDA’s level of 1,200 becquerels per kilogram that could trigger the need for health protections.

A banana typically contains around a half a gram of potassium, so it has an activity of around 15 Bq.
https://www.geocaching.com/geocache/GC4313A

The average fruit is 20 cm long and weighs about 200 grams with the peel. The skin of a ripe banana weighs approximately 80 grams, which is 40% of the total weight of the fruit. In this regard, it is generally accepted that the average weight of one banana without a skin is 120 grams.
https://tastehub.decorexpro.com/en/banan/skolko-vesit/

Therefore, 1 kg of bananas contains 15/0.120 or approximately 125 Bq/kg, which is twice as much radioactivity as was found in the shrimp.

Perhaps a political decision?

30 posted on 12/23/2025 10:16:28 AM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Red Badger

All of the poor illegal alien slaves handling our food are trying to kill us. “Death From Within”.


31 posted on 12/23/2025 10:21:10 AM PST by FlingWingFlyer (America IS NOT a nation of illegal alien criminals. We've got too many criminals in our judiciary. )
[ Post Reply | Private Reply | To 1 | View Replies]

To: fella

They use radiation to kill cancers. For all we know it may be warding off a cancer cluster.


32 posted on 12/23/2025 10:26:12 AM PST by BipolarBob (These violent delights have violent ends.)
[ Post Reply | Private Reply | To 22 | View Replies]

To: AdmSmith

Who’s gonna eat 1kg of bananas? That’s 2.2 pounds!.........


33 posted on 12/23/2025 10:32:04 AM PST by Red Badger (Iryna Zarutska, May 22, 2002 Kyiv, Ukraine – August 22, 2025 Charlotte, North Carolina Say her name)
[ Post Reply | Private Reply | To 30 | View Replies]

To: Red Badger

Hmmm...
Turn out the lights, before eating shrimp...
Do they glow in the dark...
Double check with your Geiger counter...


34 posted on 12/23/2025 10:35:57 AM PST by SuperLuminal (Where is rabble-rising Sam Adams now that we need him? Is his name Trump, now?)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Red Badger

Some food, especially seafood, spices, and mushrooms are deliberately irradiated by e-beam or Cs137. The packaging will have a little symbol called a “radura”.

Could it be that one of the food irradiators is leaking?


35 posted on 12/23/2025 10:39:13 AM PST by DBrow
[ Post Reply | Private Reply | To 1 | View Replies]

To: Red Badger

Not to worry, they can be recalled and delivered to salt water bait-and-tackle stores as glow in the dark bait.


36 posted on 12/23/2025 11:09:02 AM PST by fso301
[ Post Reply | Private Reply | To 1 | View Replies]

To: fso301

Or cat food..................


37 posted on 12/23/2025 11:12:16 AM PST by Red Badger (Iryna Zarutska, May 22, 2002 Kyiv, Ukraine – August 22, 2025 Charlotte, North Carolina Say her name)
[ Post Reply | Private Reply | To 36 | View Replies]

To: DBrow

Your granite kitchen counter can be read with a Geiger Counter.


38 posted on 12/23/2025 11:24:06 AM PST by Does so (☞GOP should fund a new party. Call it the "Muslim Party", to track it.....Dem☭¢rat ∅ ™ ½¼)
[ Post Reply | Private Reply | To 35 | View Replies]

To: Red Badger

I’ve been there!!!


39 posted on 12/23/2025 11:47:14 AM PST by Organic Panic ('Was I molested. I think so' - Ashley Biden in response to her father joining her in the shower)
[ Post Reply | Private Reply | To 5 | View Replies]

To: Organic Panic

Where is it?................


40 posted on 12/23/2025 11:48:19 AM PST by Red Badger (Iryna Zarutska, May 22, 2002 Kyiv, Ukraine – August 22, 2025 Charlotte, North Carolina Say her name)
[ Post Reply | Private Reply | To 39 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-2021-4041-51 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
General/Chat
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson