Free Republic
Browse · Search
General/Chat
Topics · Post Article

Skip to comments.

Scientists Extract Complete Human Genome From 5,700-Year-Old "Chewing Gum" – Here's What They Found
Scitech Daily ^ | December 18, 2019 | University of Copenhagen

Posted on 08/30/2024 6:20:08 PM PDT by SunkenCiv

Researchers from the University of Copenhagen have succeeded in extracting a complete human genome from a thousands-of-years-old "chewing gum". According to the researchers, it is a new untapped source of ancient DNA.

During excavations on Lolland, archaeologists have found a 5,700-year-old type of "chewing gum" made from birch pitch. In a new study, researchers from the University of Copenhagen succeeded in extracting a complete ancient human genome from the pitch.

It is the first time that an entire ancient human genome has been extracted from anything other than human bones. The new research results were published in the scientific journal Nature Communications on December 17, 2019...Based on the ancient human genome, the researchers could tell that the birch pitch was chewed by a female. She was genetically more closely related to hunter-gatherers from the mainland Europe than to those who lived in central Scandinavia at the time. They also found that she probably had dark skin, dark hair, and blue eyes...

The researchers also found DNA that could be assigned to Epstein-Barr Virus, which is known to cause infectious mononucleosis or glandular fever. According to Hannes Schroeder, ancient "chewing gums bear great potential in researching the composition of our ancestral microbiome and the evolution of important human pathogens."

(Excerpt) Read more at scitechdaily.com ...


TOPICS: History; Science; Travel
KEYWORDS: birchbarkpitch; birchbarktar; birchpitch; birchresin; birchsap; birchtar; denmark; godsgravesglyphs; helixmakemineadouble; history; mono; sap; treesap

1 posted on 08/30/2024 6:20:08 PM PDT by SunkenCiv
[ Post Reply | Private Reply | View Replies]

To: StayAt HomeMother; Ernest_at_the_Beach; 1ofmanyfree; 21twelve; 24Karet; 2ndDivisionVet; 31R1O; ...

2 posted on 08/30/2024 6:20:35 PM PDT by SunkenCiv (Putin should skip ahead to where he kills himself in the bunker.)
[ Post Reply | Private Reply | View Replies]

To: SunkenCiv

Enquiring minds want to know.


3 posted on 08/30/2024 6:31:04 PM PDT by know.your.why
[ Post Reply | Private Reply | To 1 | View Replies]

To: SunkenCiv

They also found that she probably had dark skin, dark hair, and blue eyes...
~~~~~~~~~~~~~~

Quite an intriguing combo...


4 posted on 08/30/2024 6:33:31 PM PDT by Yardstick
[ Post Reply | Private Reply | To 1 | View Replies]

To: SunkenCiv

5 posted on 08/30/2024 7:04:15 PM PDT by Secret Agent Man (Gone Galt; not averse to Going Bronson.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: SunkenCiv
She was genetically more closely related to hunter-gatherers from the mainland Europe than to those who lived in central Scandinavia at the time. They also found that she probably had dark skin, dark hair, and blue eyes...

She sounds hot!

6 posted on 08/30/2024 7:10:06 PM PDT by TigersEye (His son nicknamed him Pedo Pete. (mic drop))
[ Post Reply | Private Reply | To 1 | View Replies]

To: know.your.why; SunkenCiv

“Enquiring minds want to know.”

Lonnie Donegan -

Does Your Chewing Gum Lose its Flavour [on the bedpost overnight]?

https://www.youtube.com/watch?v=x6bFTVi0hHs


7 posted on 08/30/2024 7:15:45 PM PDT by Ezekiel (🆘️ "Come fly with US". 🔴 Ingenuity -- because the Son of David begins with MARS ♂️, aka every man)
[ Post Reply | Private Reply | To 3 | View Replies]

To: SunkenCiv

She kept her mouth in shape with all that chewing...I bet she was popular.


8 posted on 08/30/2024 7:28:04 PM PDT by Az Joe (Live free or die)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Az Joe
the researchers could tell that the birch pitch was chewed by a female

Back then they could apparently tell the difference.

Btw, has anyone asked Ketanji Brown Jackson what her thoughts are on this claim?

9 posted on 08/30/2024 7:38:04 PM PDT by Robwin ( )
[ Post Reply | Private Reply | To 8 | View Replies]

To: SunkenCiv

Determined their chewing gum sucked wind as bad as ours today.

Bazooka, it died with bazooka.


10 posted on 08/30/2024 7:39:38 PM PDT by If You Want It Fixed - Fix It
[ Post Reply | Private Reply | To 1 | View Replies]

To: TigersEye

I can hear her popping that gum as she calls out to the prehistoric dreamboat nearby to plant a big wet kiss on him and start a new case of mononucleosis in the neighborhood.


11 posted on 08/30/2024 7:44:27 PM PDT by TheGeezer
[ Post Reply | Private Reply | To 6 | View Replies]

To: Ezekiel

Darn you!


12 posted on 08/30/2024 8:10:19 PM PDT by null and void (Don't hallucinate and legislate, don't hallucinate and educate, don't hallucinate and procreate...)
[ Post Reply | Private Reply | To 7 | View Replies]

To: If You Want It Fixed - Fix It

Agreed.


13 posted on 08/30/2024 8:20:05 PM PDT by logi_cal869 (-cynicus the "concern troll" a/o 10/03/2018 /!i!! &@$%&*(@ -)
[ Post Reply | Private Reply | To 10 | View Replies]

To: TigersEye

Which is why she had mono.


14 posted on 08/31/2024 12:00:42 AM PDT by griffin (When you have to shoot, SHOOT; don't talk. -Tuco)
[ Post Reply | Private Reply | To 6 | View Replies]

To: SunkenCiv

I have been spitting my gum into the storm drain at work nearly every day, coming and going, for years. There has to be several thousand pieces down there. I wonder what future anthropologist will make of it. When I retire I’m tempted to toss in something like a naked Barbie holding a machete so they can debate whether it’s a fertility, harvest, or war shrine.


15 posted on 08/31/2024 4:39:33 AM PDT by Farmerbob
[ Post Reply | Private Reply | To 1 | View Replies]

To: SunkenCiv

They could have saved time by checking the soles of their moccasins....


16 posted on 08/31/2024 4:51:15 AM PDT by Hot Tabasco
[ Post Reply | Private Reply | To 1 | View Replies]

To: SunkenCiv
That was from 2019, in 2024 this article was published “Population genomics of post-glacial western Eurasia”

Fig. 6: Genetic relatedness across western Eurasia.

Maps showing networks of highest IBD sharing (top 10 highest sharing per individual) during different time periods for 579 imputed genomes predating 3,000 cal. bp (calibrated years before present) and located in the geographical region shown. Shading and thickness of lines are scaled to represent the amount of IBD shared between two individuals. In the earliest periods, sharing networks exhibit strong links within relatively narrow geographical regions, representing predominantly close genetic ties between small HG communities, and rarely crossing the East–West divide extending from the Baltic to the Black Sea. From around 9,000 cal. bp onwards, a more extensive network with weaker individual ties appears in the south, linking Anatolia to the rest of Europe, as early Neolithic farmer communities spread across the continent. The period 7,000–5,000 cal. bp shows more connected subnetworks of western European and eastern/northern European Neolithic farmers, while locally connected networks of HG communities prevail on the eastern side of the divide. From c. 5,000 bp onwards the divide finally collapses, and continental-wide genetic relatedness unifies large parts of western Eurasia.

IBD https://en.wikipedia.org/wiki/Identity_by_descent

it is open access https://www.nature.com/articles/s41586-023-06865-0

17 posted on 08/31/2024 5:13:16 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 1 | View Replies]

To: TheGeezer

Exactly as I immediately expected. Standing all skanky on the path, chewing with her mouth open when a customer picks her up for a quickie behind a tree. Said customer then takes mono back to the wife.


18 posted on 08/31/2024 5:18:40 AM PDT by bgill
[ Post Reply | Private Reply | To 11 | View Replies]

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
General/Chat
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson