Free Republic
Browse · Search
General/Chat
Topics · Post Article

Skip to comments.

Anti-aging drug extends life up to 25%, staves off frailty and disease
New Atlas ^ | JULY 18, 2024 | Bronwyn Thompson

Posted on 07/22/2024 12:00:37 PM PDT by Red Badger

For the first time, scientists have demonstrated how a specific protein increases in our organs as we get older and actively promotes the aging process. By blocking this activity, it could not only help us live longer, but slow the physical decline that is, right now, an inevitable part of aging.

Researchers at Duke-NUS Medical School in Singapore have previously undertaken three different studies to examine interleukin-11 (IL-11) protein expression and its role in heart and kidney, liver and lung health. The lattermost research has led to an experimental anti-IL-11 therapy that's currently in clinical trials to treat fibrotic lung disease.

Building on this work, the team identified IL-11's role in the aging process, with its increased production leading to fat accumulating in the liver and abdomen, as well as reduced muscle mass and strength. By blocking this protein expression, these hallmarks of aging could be drastically reduced.

[SNIP]

In a preclinical mouse model, the researchers found that deleting this protein provided protection against age-related decline, frailty and disease. Deleting the IL-11 gene in mice extended the lives of the animals by an average of 24.9%. When mice were given an anti-IL-11 therapeutic at 75 weeks of age (the equivalent of around 55 human years) until death, the average lifespan of male mice was increased by 22.5% and 25% in female mice.

The mice didn't just live longer, they were shielded from key signs of aging. Anti-IL-11 therapy boosted metabolism, with the animals producing calorie-burning brown fat, not problematic stores of white fat, blocked the loss of muscle mass and strength, and protected against multimorbidity and cardiometabolic diseases.

(Excerpt) Read more at newatlas.com ...


TOPICS: Education; Health/Medicine; Military/Veterans; Society
KEYWORDS: antiaging; hh2; hivaging; interleukin11

Click here: to donate by Credit Card

Or here: to donate by PayPal

Or by mail to: Free Republic, LLC - PO Box 9771 - Fresno, CA 93794

Thank you very much and God bless you.


Navigation: use the links below to view more comments.
first previous 1-2021-26 last
To: AdmSmith

If this pans out, the wealthy elites will hog it all for themselves.........


21 posted on 07/23/2024 5:24:03 AM PDT by Red Badger (Homeless veterans camp in the streets while illegals are put up in 5 Star hotels....................)
[ Post Reply | Private Reply | To 20 | View Replies]

To: Red Badger

It will not be more expensive than
https://www.fiercepharma.com/pharma/novo-nordisk-ceo-jorgensen-agrees-testify-senate-over-us-pricing-semaglutide-products

here is a patent application https://worldwide.espacenet.com/patent/search/family/073776540/publication/US2023399393A1?q=pn%3DUS2023399393A1


22 posted on 07/23/2024 6:30:38 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 21 | View Replies]

To: AdmSmith
After reading this "Emerging roles for IL-11 in inflammatory diseases" https://www.sciencedirect.com/science/article/pii/S1043466621003392?via%3Dihub
I guess that another pharmaceutical company will develop a drug against one of the inflammatory diseases that works differently, and that drug would have a side effect - increase the lifespan.
23 posted on 07/23/2024 6:41:45 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 22 | View Replies]

To: Red Badger

This is a good article “Understanding interleukin 11 as a disease gene and therapeutic target” https://portlandpress.com/biochemj/article/480/23/1987/233798/Understanding-interleukin-11-as-a-disease-gene-and


24 posted on 07/23/2024 6:52:10 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 21 | View Replies]

To: AdmSmith

I remember back in the 70’s and early 80’s ‘interleukin 2’ was supposed to be a cure for cancer..................


25 posted on 07/23/2024 7:05:49 AM PDT by Red Badger (Homeless veterans camp in the streets while illegals are put up in 5 Star hotels....................)
[ Post Reply | Private Reply | To 24 | View Replies]

To: Red Badger

Biology is tricky. IL-2 is used against melanoma https://www.curemelanoma.org/patient-eng/melanoma-treatment/immunotherapy/interleukin-2-il-2-proleukin

IL-2 can enhance the anti-tumor immune response and reduce tumor growth, as demonstrated in mouse cancer models [231]. However, the systemic administration of IL-2 is associated with adverse effects, limiting its clinical application [71]. To overcome these limitations, researchers are engineering IL-2 for improved efficacy and safety in cancer treatment.
https://molecular-cancer.biomedcentral.com/articles/10.1186/s12943-023-01826-7#Sec19

and:
IL11 was until recently accepted by the scientific community as anti-fibrotic, anti-inflammatory, and pro-regenerative; newer studies highlight that IL11 is in fact the opposite: pro-fibrotic, pro-inflammatory and anti-regenerative.

i.e. not easy.


26 posted on 07/23/2024 7:33:32 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 25 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-2021-26 last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
General/Chat
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson