Free Republic
Browse · Search
General/Chat
Topics · Post Article

To: AdmSmith

If this pans out, the wealthy elites will hog it all for themselves.........


21 posted on 07/23/2024 5:24:03 AM PDT by Red Badger (Homeless veterans camp in the streets while illegals are put up in 5 Star hotels....................)
[ Post Reply | Private Reply | To 20 | View Replies ]


To: Red Badger

It will not be more expensive than
https://www.fiercepharma.com/pharma/novo-nordisk-ceo-jorgensen-agrees-testify-senate-over-us-pricing-semaglutide-products

here is a patent application https://worldwide.espacenet.com/patent/search/family/073776540/publication/US2023399393A1?q=pn%3DUS2023399393A1


22 posted on 07/23/2024 6:30:38 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 21 | View Replies ]

To: Red Badger

This is a good article “Understanding interleukin 11 as a disease gene and therapeutic target” https://portlandpress.com/biochemj/article/480/23/1987/233798/Understanding-interleukin-11-as-a-disease-gene-and


24 posted on 07/23/2024 6:52:10 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 21 | View Replies ]

Free Republic
Browse · Search
General/Chat
Topics · Post Article


FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson