Free Republic
Browse · Search
General/Chat
Topics · Post Article

Skip to comments.

Scientists create a living organism
Financial Times ^ | 5/20/10 | Clive Cookson

Posted on 05/20/2010 10:39:53 AM PDT by mgstarr

click here to read article


Navigation: use the links below to view more comments.
first previous 1-2021-4041-6061-8081-89 next last
To: no one in particular
They're made out of meat
61 posted on 05/20/2010 7:43:58 PM PDT by null and void (We are now in day 483 of our national holiday from reality. - 0bama really isn't one of US.)
[ Post Reply | Private Reply | To 60 | View Replies]

To: r9etb
Intelligent design. But remember: it’s not science.

That was my thought when read the article. I was thinking how so many people have said that Intelligent Design is not real science, yet an intelligent agent just purposefully designed and created life. That is the basic position of ID, as I understand it.

interesting

62 posted on 05/20/2010 9:18:24 PM PDT by GregoTX (+)
[ Post Reply | Private Reply | To 35 | View Replies]

To: mgstarr
The synthetic bacteria have 14 “watermark sequences” attached to their genome – inert stretches of DNA added to distinguish them from their natural counterparts. They behaved and divided in lab dishes like natural bacteria.
Can you say; 'Andromeda Strain' kiddied?

There. I knew you could.

We be messin around with the wrong stuff here. 'Someone' will not be pleased.
And when He gets mad, it ain't all Cakes and Ale.

63 posted on 05/21/2010 3:54:19 AM PDT by Condor51 (SAT CONG!)
[ Post Reply | Private Reply | To 1 | View Replies]

To: VRWCmember

.....Did they create it, or did they fabricate it?....

How about “synthesize”

The bacteria were synthesized from four bottles


64 posted on 05/21/2010 5:13:00 AM PDT by bert (K.E. N.P. +12 . Ostracize Democrats. There can be no Democrat friends.)
[ Post Reply | Private Reply | To 4 | View Replies]

To: mgstarr; SunkenCiv

Man will never create life. Only One Being can do that or ever will be able to do it.

Man will never develop cures by killing man in the womb to do it.

If anyone claims to have done either thing, he is a liar, and it’s a hoax.


65 posted on 05/21/2010 6:02:19 AM PDT by TheOldLady
[ Post Reply | Private Reply | To 1 | View Replies]

To: GregoTX
I was thinking how so many people have said that Intelligent Design is not real science

That's because it's primarily an ideological position, as opposed to a scientific one.

Things like this don't prove that life originated as a result of ID, of course. But what it does do -- again -- is demonstrate the validity of ID as a hypothesis.

It also highlights the difficulties of the claim that ID "can't be detected." It shows a glaring blind spot for "science" in cases where ID is responsible for the phenomenon under investigation. One would think that such things would mute the arrogance of the "it's not science" crowd.... but since it's an ideological position, I guess there's no requirement for consistency.

66 posted on 05/21/2010 6:58:37 AM PDT by r9etb
[ Post Reply | Private Reply | To 62 | View Replies]

To: Scythian
Even the scientist himself is quick to point out that they didn't create a living organism: Artificial Hype...But Not Life...Created in MSM Laboratory
67 posted on 05/21/2010 7:25:06 AM PDT by VRWCmember
[ Post Reply | Private Reply | To 48 | View Replies]

To: VRWCmember

Agreed, I am shocked by the number of freepers that believe this story, that actually believed man could take mere chemicals and create life. How many more will fall for “the lie” in the book of revelation when they see “miracles before their eyes”


68 posted on 05/21/2010 7:27:50 AM PDT by Scythian
[ Post Reply | Private Reply | To 67 | View Replies]

To: Scythian
Agreed, I am shocked by the number of freepers that believe this story, that actually believed man could take mere chemicals and create life. How many more will fall for “the lie” in the book of revelation when they see “miracles before their eyes”

I'm shocked that so many FReepers are myopically focused on the religious issue of creating life, and not marveling at the possibilities this may lead to. If we can synthesize DNA, inject it into a host cell, which will then obey the commands of the synthetic DNA, then this is one helluva breakthrough. This could change medicine and agriculture as we know it. This could be as important as the discovery of electricity or fire.

69 posted on 05/21/2010 8:50:47 AM PDT by Melas
[ Post Reply | Private Reply | To 68 | View Replies]

To: Joe Brower; Moonman62; SunkenCiv; nuconvert
Dr. Venter and his colleagues wrote their names into its chemical DNA code, along with three apt quotations from James Joyce and others. These genetic watermarks will, eventually, allow the researchers to assert ownership of the cells. "You have to have a way of tracking it," said Stanford ethicist Mildred Cho, who has studied the issues posed by the creation of such organisms.

This reminds me of my days in a lab when I, and probably many others, did similar things with small strings of DNA in plasmids. You are restricted to the alphabet with A, B, C, D, E, F, G, H, I, K, L, M, N, O, P, Q, R, S, T, U, V, W and Z. No J, nor X. If you want to do it perfect and enable replication without destroying something it takes time.
70 posted on 05/21/2010 10:31:04 AM PDT by AdmSmith
[ Post Reply | Private Reply | To 17 | View Replies]

To: AdmSmith
This GCTGATATGTCTATGATTACTCAT is one representation of AdmSmith = AlaAspMetSerMetIleThrHis

Get your own DNA code http://www.vivo.colostate.edu/molkit/rtranslate/index.html

71 posted on 05/21/2010 10:48:34 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 70 | View Replies]

To: SunkenCiv

You should have this name: TCTAATAAAGAAAATTGTATTGTT


72 posted on 05/21/2010 10:50:22 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 71 | View Replies]

To: AdmSmith

Try this as well http://www.biophp.org/minitools/dna_to_protein/demo.php


73 posted on 05/21/2010 10:52:43 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 72 | View Replies]

To: Melas

It’s nothing


74 posted on 05/21/2010 11:54:12 AM PDT by Scythian
[ Post Reply | Private Reply | To 69 | View Replies]

To: SunkenCiv

75 posted on 05/21/2010 2:39:51 PM PDT by colorado tanker
[ Post Reply | Private Reply | To 57 | View Replies]

To: colorado tanker

A bacteria culture.


76 posted on 05/21/2010 2:40:37 PM PDT by colorado tanker
[ Post Reply | Private Reply | To 75 | View Replies]

To: AdmSmith

:’) I’ve never been a fan of octal.


77 posted on 05/21/2010 4:18:26 PM PDT by SunkenCiv ("Fools learn from experience. I prefer to learn from the experience of others." -- Otto von Bismarck)
[ Post Reply | Private Reply | To 72 | View Replies]

To: colorado tanker

That illustration seems a little cilia.


78 posted on 05/21/2010 5:17:56 PM PDT by SunkenCiv ("Fools learn from experience. I prefer to learn from the experience of others." -- Otto von Bismarck)
[ Post Reply | Private Reply | To 75 | View Replies]

To: SunkenCiv

:-))


79 posted on 05/22/2010 5:45:47 PM PDT by colorado tanker
[ Post Reply | Private Reply | To 78 | View Replies]

To: SunkenCiv; blam; ASA Vet; nuconvert
The original article is here http://www.sciencemag.org/cgi/content/abstract/science.1190719

Within the synthesized genome, Venter and colleagues left a watermark to clearly identify their work — four added DNA sequences whose string of bases spell out messages. The first watermark includes a code with which to decipher the others, including the names of the contributing scientists, three famous quotes, and an email address. “If people can decipher the code, they can send an email to us,” said Venter. http://www.the-scientist.com/blog/display/57443/

OK here are the four watermarks (taken from http://www.sciencemag.org/cgi/content/full/sci;science.1190719/DC1 ):
I have made a gap to make the code visible (i.e. marked the 6-frame stop sequence and the Asc I restriction sequence)

Watermark-1, 1246 base pairs
TTAACTAGCTAA

GTTCGAATATTTCTATAGCTGTACATATTGTAATGCTGATAACTAATACTGTGCGCTTGACTGTGATCCTGATAAATAACTTCTTCTGTAGGGTAGAGTTTTA
TTTAAGGCTACTCACTGGTTGCAAACCAATGCCGTACATTACTAGCTTGATCCTTGGTCGGTCATTGGGGGATATCTCTTACTAATAGAGCGGCCTATCGCGTATTCTCGCCG
GACCCCCCTCTCCCACACCAGCGGTGTAGCATCACCAAGAAAATGAGGGGAACGGATGAGGAACGAGTGGGGGCTCATTGCTGATCATAATGACTGTTTATATACTAATGC
CGTCAACTGTTTGCTGTGATACTGTGCTTTCGAGGGCGGGAGATTCGTTTTTGACATACATAAATATCATGACAAAACAGCCGGTCATGACAAAACAGCCGGTCATAATAGAT
TAGCCGGTGACTGTGAAACTAAAGCTACTAATGCCGTCAATAAATATGATAATAGCAACGGCACTGACTGTGAAACTAAAGCCGGCACTCATAATAGATTAGCCGGAGTCGT
ATTCATAGCCGGTAGATATCACTATAAGGCCCAGGATCATGATGAACACAGCACCACGTCGTCGTCCGAGTTTTTTTGCTGCGACGTCTATACCACGGAAGCTGATCATAAAT
AGTTTTTTTGCTGCGGCACTAGAGCCGGACAAGCACACTACGTTTGTAAATACATCGTTCCGAATTGTAAATAATTTAATTTCGTATTTAAATTATATGATCACTGGCTATAGTC
TAGTGATAACTACAATAGCTAGCAATAAGTCATATATAACAATAGCTGAACCTGTGCTACATATCCGCTATACGGTAGATATCACTATAAGGCCCAGGACAATAGCTGAACTGA
CGTCAGCAACTACGTTTAGCTTGACTGTGGTCGGTTTTTTTGCTGCGACGTCTATACGGAAGCTCATAACTATAAGAGCGGCACTAGAGCCGGCACACAAGCCGGCACAGT
CGTATTCATAGCCGGCACTCATGACAAAACAGC

GGCGCGCCTTAACTAGCTAA

Watermark-2 1081 base pairs
TTAACTAGCTAA

CAACTGGCAGCATAAAACATATAGAACTACCTGCTATAAGTGATACAACTGTTTTCATAGTAAAACATACAACGTTGCTGATAGTACTCCTAAGTGATAGCTT
AGTGCGTTTAGCATATATTGTAGGCTTCATAATAAGTGATATTTTAGCTACGTAACTAAATAAACTAGCTATGACTGTACTCCTAAGTGATATTTTCATCCTTTGCAATACAATAA
CTACTACATCAATAGTGCGTGATATGCCTGTGCTAGATATAGAACACATAACTACGTTTGCTGTTTTCAGTGATATGCTAGTTTCATCTATAGATATAGGCTGCTTAGATTCCCT
ACTAGCTATTTCTGTAGGTGATATACGTCCATTGCATAAGTTAATGCATTTAACTAGCTGTGATACTATAGCATCCCCATTCCTAGTGCATATTTTCATCCTAGTGCTACGTGAT
ATAATTGTACTAATGCCTGTAGATAATTTAATGCCTGGCTCGTTTGTAGGTGATAATTTAGTGCCTGTAAAACATATACCTGAGTGCTCGTTGCGTGATAGTTCGTTCATGCAT
ATACAACTAGGCTGCTGTGATATGGTCACTGCCCTTACTGTGCTACATATTACTGCGAGGGGGATGACGTATAAACCTGTTGTAAGTGATATGACGTATATAACTACTAGTGA
TATGACGTATAGGCTAGAACAACGTGATATGACGTATATGACTACTGTCCCAAACATCAGTGATATGACGTATACTATAATTTCTATAATAGTGATAAATAAACCTGGGCTAAA
TACGTTCCTGAATACGTGGCATAAACCTGGGCTAACGAGGAATACCCATAGTTTAGCAATAAGCTATAGTTCGTCATTTTTAA

GGCGCGCCTTAACTAGCTAA

Watermark-3 1109 base pairs
TTAACTAGCTAA

TTTAACCATATTTAAATATCATCCTGATTTTCACTGGCTCGTTGCGTGATATAGATTCTACTGTAGTGCTAGATAGTTCTGTACTAGGTGATACTATAGATTTC
ATAGATAGCACTACTGGCTTCATGCTAGGCATCCCAATAGCTAGTGATAGTTTAGTGCATACAACGTCATGTGATACAACGTTGCTGGCTGTAGATACAACGTCGTATTCTGT
AAGTGATACAATAGCTATTGCTGTGCATAGGCCTATAGTGGCTGTAACTAGTGATATCACGTAACAACCATATAAGTTAGATTTAATGCCCCTGACTGAACGCTCGTTGCGTG
ATAGTTTAGGCTCGTTGCATACAACTGTGATTTTCATAAAACAACGTGATAATTTAGTGCTAGATAAGTTCCGCTTAGCAAGTGATAGTTTCCGCTTGACTGTGCATAGTTCGT
TCATGCGCTCGTTGCGTGATAAACTAGGCAGCTTCACAACTGATAATTTAATTGCTGATATTGCTGGCTGTCTAGTGCTAGTGATCATAGTGCGTGATAGTTTAAGCTGCTCT
GTTTTAGATATCACGTGCTTGATAATGAAACTAACTAGTGATACTACGTAGTTAACTATGAATAGGCCTACTGTAAATTCAATAGTGCGTGATATTGAACTAGATTCTGCAACTG
CTAATATGCCGTGCTGCACGTTTGGTGATAGTTTAGCATGCTTCACTATAATAAATATGGTAGTTGTAACTACTGCGAATAGGGGGAGCTTAATAAATATGATCACTGTGCTAC
GCTATATGCCGTTGAATATAGGCTATATGATCATAACATATATAGCTATAAGTGATAAGTTCCTGAATATAGGCTATATGATCATAACATATACAACTGTACTCATGAATAAGTT
AACGAGGA

TTAACTAGCTAA

Watermark-4 1222 base pairs
TTAACTAGCTAA

TTTCATTGCTGATCACTGTAGATATAGTGCATTCTATAAGTCGCTCCCACAGGCTAGTGCTGCGCACGTTTTTCAGTGATATTATCCTAGTGCTACATAACA
TCATAGTGCGTGATAAACCTGATACAATAGGTGATATCATAGCAACTGAACTGACGTTGCATAGCTCAACTGTGATCAGTGATATAGATTCTGATACTATAGCAACGTTGCGT
GATATTTTCACTACTGGCTTGACTGTAGTGCATATGATAGTACGTCTAACTAGCATAACTAGTGATAGTTATATTTCTATAGCTGTACATATTGTAATGCTGATAACTAGTGATA
TAATCCAACTAGATAGTCCTGAACTGATCCCTATGCTAACTAGTGATAAACTAACTGATACATCGTTCCTGCTACGTGATAGCTTCACTGAGTTCCATACATCGTCGTGCTTAA
ACATCAGTGATAACACTATAGAGTTCATAGATACTGCATTAACTAGTGATATGACTGCAAATAGCTTGACGTTTTGCAGTCTAAAACAACGTGATAATTCTGTAGTGCTAGATA
CTATAGATTTCCTGCTAAGTGATAAGTCTACTGATTTACTAATGAATAGCTTGGTTTTGGCATACACTGTGCGCTGCACTGGTGATAGCTTTTCGTTGATGAATAATTTCCCTA
GCACTGTGCGTGATATGCTAGATTCTGTAGATAGGCTAAATTCGTCTACGTTTGTAGGTGATAGTTTAGTTGCTGTAACTAATATTATCCCTGTGCCGTTGCTAAGCTGTGATA
TCATAGTGCTGCTAGATATGATAAGCAAACTAATAGAGTCGAGGGGGAGTCTCATAGTGAATACTGATATTTTAGTGCTGCCGTTGAATAAGTTCCCTGAACATTGTGATACT
GATATTTTAGTGCTGCCGTTGAATATCCTGCATTTAACTAGCTTGATAGTGCATTCGAGGAATACCCATACTACTGTTTTCATAGCTAATTATAGGCTAACATTGCCAATAGTGC

GGCGCGCCTTAACTAGCTAA
Figure S1

The team created a code that spells out the 26 letters of the alphabet, the numbers 0 to 9 and several punctuation marks. They then wrote a message which reveals the code. A second missive was a string of 'letters' corresponding to the names of 46 people involved in the project. A third gave an e-mail address where people can write once they crack the code and the fourth listed three philosophical quotes.

80 posted on 05/23/2010 4:42:21 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 73 | View Replies]


Navigation: use the links below to view more comments.
first previous 1-2021-4041-6061-8081-89 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
General/Chat
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson