Free Republic
Browse · Search 		General/Chat
Topics · Post Article

To: AdmSmith
This GCTGATATGTCTATGATTACTCAT is one representation of AdmSmith = AlaAspMetSerMetIleThrHis

Get your own DNA code http://www.vivo.colostate.edu/molkit/rtranslate/index.html

71 posted on 05/21/2010 10:48:34 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 70 | View Replies ]

To: SunkenCiv

You should have this name: TCTAATAAAGAAAATTGTATTGTT


72 posted on 05/21/2010 10:50:22 AM PDT by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 71 | View Replies ]

Free Republic
Browse · Search 		General/Chat
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson