[AdmSmith]

Dr. Venter and his colleagues wrote their names into its chemical DNA code, along with three apt quotations from James Joyce and others. These genetic watermarks will, eventually, allow the researchers to assert ownership of the cells. "You have to have a way of tracking it," said Stanford ethicist Mildred Cho, who has studied the issues posed by the creation of such organisms.

This reminds me of my days in a lab when I, and probably many others, did similar things with small strings of DNA in plasmids. You are restricted to the alphabet with A, B, C, D, E, F, G, H, I, K, L, M, N, O, P, Q, R, S, T, U, V, W and Z. No J, nor X. If you want to do it perfect and enable replication without destroying something it takes time.

[AdmSmith]

This GCTGATATGTCTATGATTACTCAT is one representation of AdmSmith = AlaAspMetSerMetIleThrHis

Get your own DNA code http://www.vivo.colostate.edu/molkit/rtranslate/index.html