Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

Skip to comments.

Guide on how to remove Graphene, the substance being transmitted from the COVID-19 vaccinated to the Unvaccinated, from your body…
The Exposé ^ | 12/25/23 | The Exposé

Posted on 12/26/2023 2:05:31 PM PST by Roman_War_Criminal

Graphene oxide, a substance that is poisonous to humans, has allegedly been found in the Covid 19 “vaccines”, in the water supply, in the air we breathe through chemtrails, and is even in our food supply.

It interacts and is activated by electromagnetic frequencies (“EMF”), specifically the broader range of frequencies found in 5G which can cause even more damage to our health.

The symptoms of graphene oxide poisoning and EMF radiation sickness are similar to those symptoms described as Covid.

The bad news for those who have so far refused to get a single dose of the Covid-19 injection is that some doctors believe Graphene is being transmitted from the Covid-19 vaccinated to the unvaccinated.

But the good news is, now that graphene oxide has been identified as a contaminant, there are ways to remove graphene oxide from your body and restore your health.

(Excerpt) Read more at expose-news.com ...


TOPICS: Conspiracy; Government; Health/Medicine; Society
KEYWORDS: batsinthebelfry; carbon; chinavirusvaccine; coniracysite; covid; deathjabs; dumbingdownfr; freepathonkiller; graphene; grapheneoxide; graphyne; qtardnonsense; retardedgarbage; suicideshots; theexcrement
Navigation: use the links below to view more comments.
first 1-2021-32 next last

1 posted on 12/26/2023 2:05:31 PM PST by Roman_War_Criminal
[ Post Reply | Private Reply | View Replies]

To: Roman_War_Criminal

Hilarious


2 posted on 12/26/2023 2:06:42 PM PST by Mariner (War Criminal #18)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Roman_War_Criminal

We are exposed everyday to Electromagnetic Radiation. It’s called ‘Sunlight’. Oh the horror!


3 posted on 12/26/2023 2:10:02 PM PST by Nateman (If the Pedo Profit Mad Moe (pig pee upon him!) was not the Antichrist then he comes in second.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Roman_War_Criminal

This is absolute hogwash.


4 posted on 12/26/2023 2:13:59 PM PST by ConservativeMind (Trump: Befuddling Democrats, Republicans, and the Media for the benefit of the US and all mankind.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Roman_War_Criminal

I have not gotten, and will not get, any Covid shots.

That said, I am going to live my life, knowing full well that living in modern society might well expose me to toxins that were unknown to my great-great-grandparents, including some that we do not yet know about. They in turn had exposures and risks that are all but eliminated today. It is the human condition.

I will certainly die of something It might be from that steak that I cooked over a pile of burning linoleum. It might be from a drive by shooting, or a stroke from too much comfort eating, or an unknown gene weakness that asserts itself at some unknown date. I do not know. I am not going to extend all my emotional energy trying to MAYBE maximize my time here on earth.

I want to be like Matt Dillon . . . not looking for trouble, but not looking to run away from it, either.


5 posted on 12/26/2023 2:15:45 PM PST by Dr. Sivana ("If you can’t say something nice . . . say the Rosary." [Red Badger])
[ Post Reply | Private Reply | To 1 | View Replies]

To: Mariner

“specifically the broader range of frequencies found in 5G”

That’s funny right there, I don’t care who you are.


6 posted on 12/26/2023 2:17:20 PM PST by JSM_Liberty
[ Post Reply | Private Reply | To 2 | View Replies]

To: Roman_War_Criminal

Electro Magnetic Frequencies - what fifth grade comic book reader wrote this nonsense?


7 posted on 12/26/2023 2:21:29 PM PST by bigbob
[ Post Reply | Private Reply | To 1 | View Replies]

To: Dr. Sivana

Exactly.
Given all the drugs we put in our bodies and is released into the sewers and not properly treated then works it way up the food hain, there’s no telling what delirious effects it’s having in our world.
I suspect it’s being infested by pregnant women and, to some, it’s messing up their child’s hormones which is why we’re having so many gender confused kids who don’t know who they are.
And there’s no easy answer to the problem


8 posted on 12/26/2023 2:27:14 PM PST by RedMonqey ("A republic, if you can keep it" Benjam Franklin.)
[ Post Reply | Private Reply | To 5 | View Replies]

To: JSM_Liberty

Lord, I apologize for that there, and...be with the pygmies in New Guinea, amen.


9 posted on 12/26/2023 2:37:48 PM PST by maddog55 (The only thing systemic in America is the left's hatred of it!)
[ Post Reply | Private Reply | To 6 | View Replies]

To: AdmSmith; AnonymousConservative; Arthur Wildfire! March; Berosus; Bockscar; BraveMan; cardinal4; ...
NTSA from the graphene keyword:

10 posted on 12/26/2023 2:41:14 PM PST by SunkenCiv (Putin should skip ahead to where he kills himself in the bunker.)
[ Post Reply | Private Reply | View Replies]

To: Roman_War_Criminal
“… specifically the broader range of frequencies found in 5G which can cause even more damage to our health.”

Don’t tell this genius about a square wave. Instant death.

11 posted on 12/26/2023 2:49:45 PM PST by mikey_hates_everything
[ Post Reply | Private Reply | To 1 | View Replies]

To: SunkenCiv

What to do with the colorless and odorless chemical compound Dihydrogen Monoxide (DHMO)?


12 posted on 12/26/2023 2:51:52 PM PST by AdmSmith (GCTGATATGTCTATGATTACTCAT)
[ Post Reply | Private Reply | To 10 | View Replies]

To: Roman_War_Criminal

I had a double-major in college of Spanish and archaeology, that was until I found out you cannot pay the mortgage, or most any thing else, with archaeology.

Archaeology still fascinates me. Not so very long ago, we lived much shorter lives. I laugh at the “we’re all gonna die” stories. I also find it amusing that people want to ‘conquer death’ and find the key to immortality. Then there are the “back in the good ‘ol days” crowd. Just how far back do you want to go? Back before penicillin, refrigeration? If you have traveled, you know that we who have been born in America are so lucky. The ‘poor’ in America live better the kings of Europe not so long ago.

PS... I do not have a PhD in archaeology, anthropology, or anything else, but I laughed so hard when that ‘expert’ PhD anthropologist stated we cannot determine the sex of the skeletal remains. He epitomizes the real meaning of PhD:

Piled
Higher &
Deeper


13 posted on 12/26/2023 2:53:29 PM PST by Ronaldus Magnus III (Do, or do not, there is no try)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Roman_War_Criminal
Sorry, this doesn't rate high enough to earn the label "conspiracy theory". Those have some basis in fact.

This is just 100% low-grade bullspit.

14 posted on 12/26/2023 2:59:00 PM PST by dayglored (Strange Women Lying In Ponds Distributing Swords! Arthur Pendragon in 2024)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Roman_War_Criminal
The article forgot to mention that graphene oxide nanoparticles align themselves to form little electronic circuits in your bloodstream that produce wireless 5G transmissions, they don't even need a battery or an antenna because they use energy from your body, and you can prove they're doing it because you can use a WiFi access point to read out the MAC address of the graphene oxide circuit.

I know it's true because I saw a YouTube video that said it was true. So there.

15 posted on 12/26/2023 3:05:50 PM PST by dayglored (Strange Women Lying In Ponds Distributing Swords! Arthur Pendragon in 2024)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Roman_War_Criminal

LOL
Babylon Bee is hilarious.


16 posted on 12/26/2023 3:07:08 PM PST by Rightwing Conspiratr1
[ Post Reply | Private Reply | To 1 | View Replies]

To: Roman_War_Criminal

So that fountain of irrefutable knowledge, the Expose, has published an article for the truly gullible on how to remove a substance that isn’t there.

Typical anti-vaxxer horse hockey.


17 posted on 12/26/2023 3:30:04 PM PST by DugwayDuke (Most pick the expert who says the things they agree with.)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Roman_War_Criminal

18 posted on 12/26/2023 3:55:29 PM PST by conservativeimage (Divorce the Deep State Peacefully: Become a State National: https://tasa.americanstatenationals.org)
[ Post Reply | Private Reply | To 1 | View Replies]

To: Dr. Sivana

Maintain a good diet and take a quality multi, daily.


19 posted on 12/26/2023 4:04:16 PM PST by Tommy Revolts
[ Post Reply | Private Reply | To 5 | View Replies]

To: Tommy Revolts

You forgot to add: And say your prayers each night at bedtime.


20 posted on 12/26/2023 4:15:01 PM PST by sport
[ Post Reply | Private Reply | To 19 | View Replies]


Navigation: use the links below to view more comments.
first 1-2021-32 next last

Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.

Free Republic
Browse · Search
Bloggers & Personal
Topics · Post Article

FreeRepublic, LLC, PO BOX 9771, FRESNO, CA 93794
FreeRepublic.com is powered by software copyright 2000-2008 John Robinson