Posted on 08/13/2003 9:02:05 PM PDT by nwrep
2 hours, 55 minutes ago
|
|
By RAMOLA TALWAR BADAM, Associated Press Writer
BOMBAY, India - U.S. and Indian scientists said Wednesday they have discovered a new carnivorous dinosaur species in India after finding bones in the western part of the country.
|
The new dinosaur species was named Rajasaurus narmadensis, or "Regal reptile from the Narmada," after the Narmada River region where the bones were found.
The dinosaurs were between 25-30 feet long, had a horn above their skulls, were relatively heavy and walked on two legs, scientists said. They preyed on long-necked herbivorous dinosaurs on the Indian subcontinent during the Cretaceous Period at the end of the dinosaur age, 65 million years ago.
"It's fabulous to be able to see this dinosaur which lived as the age of dinosaurs came to a close," said Paul Sereno, a paleontologist at the University of Chicago. "It was a significant predator that was related to species on continental Africa, Madagascar and South America."
Working with Indian scientists, Sereno and paleontologist Jeff Wilson of the University of Michigan reconstructed the dinosaur skull in a project funded partly by the National Geographic (news - web sites) Society.
A model of the assembled skull was presented Wednesday by the American scientists to their counterparts from Punjab University in northern India and the Geological Survey of India during a Bombay news conference.
Scientists said they hope the discovery will help explain the extinction of the dinosaurs and the shifting of the continents how India separated from Africa, Madagascar, Australia and Antarctica and collided with Asia.
The dinosaur bones were discovered during the past 18 years by Indian scientists Suresh Srivastava of the Geological Survey of India and Ashok Sahni, a paleontologist at Punjab University.
When the bones were examined, "we realized we had a partial skeleton of an undiscovered species," Sereno said.
The scientists said they believe the Rajasaurus roamed the Southern Hemisphere land masses of present-day Madagascar, Africa and South America.
"People don't realize dinosaurs are the only large-bodied animal that lived, evolved and died at a time when all continents were united," Sereno said.
The cause of the dinosaurs' extinction is still debated by scientists. The Rajasaurus discovery may provide crucial clues, Sereno said.
India has seen quite a few paleontological discoveries recently.
In 1997, villagers discovered about 300 fossilized dinosaur eggs in Pisdura, 440 miles northeast of Bombay, that Indian scientists said were laid by four-legged, long-necked vegetarian creatures.
Indian scientists said the dinosaur embryos in the eggs may have suffocated during volcanic eruptions.
No need to "assume" it. Known (i.e. measured) rates of accumulation of mutations in a population match quite well the amount of genetic difference between modern species versus their apparent ancestral link.
If you're a girl, or if you just like to watch ...
And note that Spetner's claim that "mutations can't don't information" rests upon a extremely, um, unusual definition of "information" which only Spetner subscribes to, so if DittoJed2's source is Spetner, it's going to be a fun ride.
But Ditto has already announced that evidence doesn't matter.
Hey! You're NOT selling it, AND you were supposed to keep that island a secret! Now where will put our phase-linked radiotelescopes???
No genetic differences between man and modern apes has yet been found to be of a type that is out of the ordinary for genetic mutations.
For example, check out this example:
The differences between, say, man and chimp are just a very small number of point mutations, plus 5 basepairs tacked on the end which may be the tail-end "fuzz" that sometimes accumulates on genes during copying (and which gorillas and orangutans don't even have either).CHRM2 gene for muscarinic acetylcholine receptor m2, partial cds updated: 9/11/00 seq id sequence name ----------------------------- 1 human (M16404 in Database) - local file - 2 human (SN; AB041391 determined by Silver Project) - local file - 3 chimpanzee (220; AB041392 determined by Silver Project) - local file - 4 gorilla (U1; AB041393 determined by Silver Project) - local file - 5 orangutan (U1; AB041394 determined by Silver Project) - local file -nucleotides 1 - 60 1 ttgtcctggtggctggatccctcagtttggtgaccattatcgggaacatcctagtcatgg 2 ............................................................ 3 ............................................................ 4 ............................................................ 5 ............................................................ ------------------------------------------------------------ nucleotides 61 - 120 1 tttccattaaagtcaaccgccacctccagaccgtcaacaattactttttattcagcttgg 2 ............................................................ 3 ............................................................ 4 .................................................g.......... 5 ...............................t.................g.......... -------------------------------+-----------------+---------- nucleotides 121 - 180 1 cctgtgctgaccttatcataggtgttttctccatgaacttgtacaccctctacactgtga 2 ............................................................ 3 ............................................................ 4 ............................................................ 5 ............................................................ ------------------------------------------------------------ nucleotides 181 - 240 1 ttggttactggcctttgggacctgtggtgtgtgacctttggctagccctggactatgtgg 2 ............................................................ 3 ............................................................ 4 ............................................................ 5 .........................t.................................. -------------------------+---------------------------------- nucleotides 241 - 300 1 tcagcaatgcctcagttatgaatctgctcatcatcagctttgacaggtacttctgtgtca 2 ............................................................ 3 ............................................................ 4 ............................................................ 5 .............g.............................................. -------------+---------------------------------------------- nucleotides 301 - 360 1 caaaacctctgacctacccagtcaagcggaccacaaaaatggcaggtatgatgattgcag 2 ............................................................ 3 ............................................................ 4 ............................................................ 5 ............................................................ ------------------------------------------------------------ nucleotides 361 - 420 1 ctgcctgggtcctctctttcatcctctgggctccagccattctcttctggcagttcattg 2 ............................................................ 3 ............................................................ 4 ............................................................ 5 ............................................................ ------------------------------------------------------------ nucleotides 421 - 480 1 taggggtgagaactgtggaggatggggagtgctacattcagtttttttccaatgctgctg 2 ............................................................ 3 ............................................................ 4 ............................................................ 5 ............................................................ ------------------------------------------------------------ nucleotides 481 - 540 1 tcacctttggtacggctattgcagccttctatttgccagtgatcatcatgactgtgctat 2 ............................................................ 3 ............................................................ 4 ................c........................................... 5 ................c.........................................g. ----------------+-----------------------------------------+- nucleotides 541 - 600 1 attggcacatatcccgagccagcaagagcaggataaagaaggacaagaaggagcctgttg 2 ............................................................ 3 .................................................a.......... 4 ............................................................ 5 .c.......................................................... -+-----------------------------------------------+---------- nucleotides 601 - 660 1 ccaaccaagaccccgtttctccaagtctggtacaaggaaggatagtgaagccaaacaata 2 ............................................................ 3 ............................................................ 4 ............................................................ 5 ............................................................ ------------------------------------------------------------ nucleotides 661 - 720 1 acaacatgcccagcagtgacgatggcctggagcacaacaaaatccagaatggcaaagccc 2 ............................................................ 3 ............................................................ 4 ............................................................ 5 ............................................................ ------------------------------------------------------------ nucleotides 721 - 780 1 ccagggatcctgtgactgaaaactgtgttcagggagaggagaaggagagctccaatgact 2 ............................................................ 3 ............................................................ 4 ............................................................ 5 ....a................................a...................... ----+--------------------------------+---------------------- nucleotides 781 - 840 1 ccacctcagtcagtgctgttgcctctaatatgagagatgatgaaataacccaggatgaaa 2 ............................................................ 3 ............................................................ 4 ............................................................ 5 ........................................c................... ----------------------------------------+------------------- nucleotides 841 - 900 1 acacagtttccacttccctgggccattccaaagatgagaactctaagcaaacatgcatca 2 ............................................................ 3 ............................................................ 4 ............................................................ 5 .......c................................t................... -------+--------------------------------+------------------- nucleotides 901 - 960 1 gaattggcaccaagaccccaaaaagtgactcatgtaccccaactaataccaccgtggagg 2 ............................................................ 3 ............................................................ 4 ............................................................ 5 ...................c....t.............t..................... -------------------+----+-------------+--------------------- nucleotides 961 - 1020 1 tagtggggtcttcaggtcagaatggagatgaaaagcagaatattgtagcccgcaagattg 2 ............................................................ 3 ............................................................ 4 ............................................................ 5 .......a.................................................... -------+---------------------------------------------------- nucleotides 1021 - 1080 1 tgaagatgactaagcagcctgcaaaaaagaagcctcctccttcccgggaaaagaaagtca 2 ............................................................ 3 ............................................................ 4 ................n........................................... 5 ............................................................ ----------------+------------------------------------------- nucleotides 1081 - 1140 1 ccaggacaatcttggctattctgttggctttcatcatcacttgggccccatacaatgtca 2 ............................................................ 3 ............................................................ 4 ............................................................ 5 ............................................................ ------------------------------------------------------------ nucleotides 1141 - 1200 1 tggtgctcattaacaccttttgtgcaccttgcatccccaacactgtgtggacaattggtt 2 ............................................................ 3 ............................................................ 4 ............................................................ 5 ............................................................ ------------------------------------------------------------ nucleotides 1201 - 1260 1 actggctttgttacatcaacagcactatcaaccctgcctgctatgcactttgcaatgcca 2 ............................................................ 3 ....................................................t....... 4 ....................................................t....... 5 ....................................................t....... ----------------------------------------------------+------- nucleotides 1261 - 1320 1 ccttcaagaagacctttaaacaccttctcatgtgtcattataagaacataggcgctacaa 2 ............................................................ 3 ............................................................ 4 ............................................................ 5 ............................................................ ------------------------------------------------------------ nucleotides 1321 - 1332 1 ggtaaaa----- 2 ............ 3 .......tatct 4 ............ 5 ............ -------+++++
And, a dinosaur with feathers is a dinosaur.
A dinosaur with bird-like features ;)
The problem is you seem to think that these categories (dinosaur, bird) are somehow fixed with sharp boundaries. But this is not the case. You have a population that changes over time and somehow you have to subdivide this continuum. Now where do you draw the line? This can be as arbitrary as determining at which wavelength green ends and blue begins.
Not necessarily. I think Sinornithosaurus would suffice.
Problems with a Global Flood, 2nd Edition.Runaway subduction. John Baumgardner created the runaway subduction model, which proposes that the pre-Flood lithosphere (ocean floor), being denser than the underlying mantle, began sinking. The heat released in the process decreased the viscosity of the mantle, so the process accelerated catastrophically. All the original lithosphere became subducted; the rising magma which replaced it raised the ocean floor, causing sea levels to rise and boiling off enough of the ocean to cause 150 days of rain. When it cooled, the ocean floor lowered again, and the Flood waters receded. Sedimentary mountains such as the Sierras and Andes rose after the Flood by isostatic rebound. [Baumgardner, 1990a; Austin et al., 1994]
- The main difficulty of this theory is that it admittedly doesn't work without miracles. [Baumgardner, 1990a, 1990b] The thermal diffusivity of the earth, for example, would have to increase 10,000 fold to get the subduction rates proposed [Matsumura, 1997], and miracles are also necessary to cool the new ocean floor and to raise sedimentary mountains in months rather than in the millions of years it would ordinarily take.
- Baumgardner estimates a release of 1028 joules from the subduction process. This is more than enough to boil off all the oceans. In addition, Baumgardner postulates that the mantle was much hotter before the Flood (giving it greater viscosity); that heat would have to go somewhere, too.
- Cenozoic sediments are post-Flood according to this model. Yet fossils from Cenozoic sediments alone show a 65-million-year record of evolution, including a great deal of the diversification of mammals and angiosperms. [Carroll, 1997, chpts. 5, 6, & 13]
- Subduction on the scale Baumgardner proposes would have produced very much more vulcanism around plate boundaries than we see. [Matsumura, 1997]
Bah: Never post when you're in a hurry.
That should, of course, be "mutations don't add information".
Disclaimer: Opinions posted on Free Republic are those of the individual posters and do not necessarily represent the opinion of Free Republic or its management. All materials posted herein are protected by copyright law and the exemption for fair use of copyrighted works.